TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-943
miRNA Sequence: CUGACUGUUGCCGUCCUCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000115chr1322396 1908 1762 1246 --
NM_000202chrX53250 2899 2602 1171 1161 11446 1249 --
NM_000222chr432121 853 364 ----1812
NM_000314chr1042654 2441 2361 110 1976 1605 --
NM_000337chr585779 5417 5010 4956 4483 1840 1598 453 ----24888 731
NM_000461chr323578 3502 --14423 24085 1831
NM_000555chrX67132 7024 6384 2485 2173 336 --21195 198 12653
NM_000813chr555282 5103 3651 3630 338 24370 208 24269 4259 14097
NM_000833chr1621243 533 ----1467
NM_000875chr1595613 5561 5333 4853 4846 4624 4490 2581 1162 11092 ----
NM_000899chr1274183 3440 3431 1675 1494 769 50 ------
NM_000901chr472439 1601 999 692 560 195 117 1275 --22082 422
NM_000965chr3--1294 1796 1494
NM_001003652chr18168688 7728 6968 6760 5243 3325 3292 2686 2618 2492 2190 2153 1846 1821 1350 921 1828 1641 36876 5957 5263
NM_001004065chr953007 2746 2652 2443 542 --33975 2866 779 --
NM_001004419chr1263630 3017 1489 1009 792 707 --23496 723 14145
NM_001005386chr232457 2399 818 ----12025
NM_001005473chr586560 5504 4303 4055 1680 1428 1224 510 --1501 --
NM_001009554chr464151 3858 1866 1211 1150 569 ----1759
NM_001009899chr386353 6162 4473 4153 1163 795 518 125 32583 2326 829 --15924
NM_001009909chr1123861 3444 11093 23607 207 33916 1248 1106
NM_001009959chr24927 627 329 266 12013 --1795
NM_001009960chr762738 2244 697 453 298 110 21752 365 ----
NM_001010888chrX74147 3926 1718 1294 1243 1062 727 --24647 4172 14229
NM_001010891chr586255 5944 2560 2318 1757 1626 1570 1028 21312 982 11820 --
NM_001013415chr421461 1246 --1527 11338
NM_001014797chr10117150 7077 5806 5344 2883 2832 2009 1824 1456 1137 739 11381 1355 --
NM_001015877chrX22931 977 ----1270
NM_001024688chr812018 --1254 11459
NM_001025076chr10105712 5232 4783 4375 4240 4190 3985 1871 471 399 --1693 24068 3870
NM_001025108chr294069 3933 3691 3166 1517 1378 1328 1187 820 ------
NM_001029863chr62620 154 1110 11040 1719
NM_001033045chr253217 3034 2694 1631 812 --1255 14169
NM_001033503chr51461 ----1422
NM_001034841chr1695307 3705 1833 1448 1342 1275 1179 750 168 184 13562 15443
NM_001034850chr541693 1649 364 343 --11675 --
NM_001039590chrX64010 1611 1125 850 804 53 ------
NM_001039618chr1164846 4261 1517 824 615 211 12285 1269 1717
NM_001040157chr422783 497 ----1457
NM_001040712chr953376 2789 1200 976 182 --1969 --
NM_001042413chr961603 1565 1205 831 781 185 --13685 --
NM_001042494chr1553801 3782 1328 811 183 1257 13550 --
NM_001106chr3129728 9516 9050 8805 8230 8081 8008 7903 7688 7357 1895 1264 26524 2764 26346 3605 --
NM_001186chr2152937 2872 2781 2748 2176 ----13284
NM_001201chr473818 3629 1467 1111 1061 777 689 13853 22781 129 13659
NM_001204chr247482 6425 5162 1923 15450 12054 --
NM_001241chr2----11957 12321
NM_001396chr2162631 2461 2434 1765 912 266 --12605 --
NM_001650chr1823756 547 --23988 442 1375
NM_001759chr1274949 4309 4005 2069 1441 1120 936 --25195 243 --
NM_001858chr653686 3469 3354 3227 1246 --13882 --
NM_001969chr1453565 3216 2963 2706 1396 13401 23645 275 --
NM_002025chrX88651 8376 1919 1043 940 808 277 204 27405 6093 ----
NM_002033chr1153842 3125 1555 1147 551 --1794 11267
NM_002040chr2152192 1022 940 359 111 --43147 2697 2341 261 --
NM_002158chr253678 2777 2345 1257 1239 13006 --11470
NM_002193chr251904 1653 1486 338 43 1180 1104 11552
NM_002211chr1031115 1080 407 1932 262 56 --
NM_002214chr744908 1987 1969 463 14968 25663 103 --
NM_002336chr1244280 3802 3479 1244 34563 1751 459 13885 1118
NM_002356chr652755 1011 892 701 641 ----12472
NM_002581chr995503 4823 3984 3465 2123 924 587 562 249 11517 172 --
NM_002645chr1122164 2067 --2181 38 12277
NM_002670chr3151 ----1187
NM_002709chr222274 645 1293 --1207
NM_002734chr1721397 379 ----1193
NM_002906chr1142253 2110 1524 527 --1673 22277 1651
NM_003234chr322112 310 --22329 973 1503
NM_003262chr354083 1280 412 187 138 --1257 1282
NM_003413chrX41709 1411 571 413 11936 ----
NM_003885chr1752354 1862 1018 802 121 ----12383
NM_003902chr12824 786 ----1717
NM_003930chr752069 2054 865 312 140 1211 12435 12013
NM_004162chr32344 29 ----2828 311
NM_004171chr11128952 8744 8499 7880 6285 3540 2980 2281 1146 1134 962 591 27557 3757 37189 3025 1621 1787
NM_004232chr1873664 3536 3377 3054 2540 1399 60 32640 2547 923 ----
NM_004458chrX22540 24 --12164 12376
NM_004586chrX74679 4013 3445 1811 605 469 380 --1241 --
NM_004713chr14------2512 220
NM_004738chr2072562 2296 2178 1708 1659 997 415 12095 --2964 767
NM_004852chr181413027 12972 11457 11299 10377 10343 10045 5728 4784 4244 2283 1031 745 384 212345 3057 29585 3997 114303
NM_004929chr841225 525 227 178 --11296 --
NM_004956chr734384 4313 4297 21179 793 --33640 3137 388
NM_004973chr631638 399 199 --1225 11548
NM_004992chrX126250 3414 3119 2912 2889 2329 2219 2131 1649 939 878 497 26861 2772 1207 --
NM_005121chr1751160 897 664 307 268 23214 2927 ----
NM_005156chr965152 4618 4231 3951 3602 886 1184 14397 --
NM_005180chr1021625 1378 --11505 11199
NM_005188chr1152297 1589 1548 942 286 11469 18291 13322
NM_005339chr433778 2691 946 --11178 23315 27
NM_005475chr1262960 2697 2000 859 707 672 --22791 751 --
NM_005596chr945988 5701 1239 758 16395 26165 1670 15151
NM_005639chr1221590 1421 ----1492
NM_005668chr574322 4175 3705 1842 1589 476 235 12960 --12944
NM_005813chr22909 390 1951 21808 962 12159
NM_005843chr241621 1502 755 239 --1771 11901
NM_005909chr574178 3600 3452 2790 2684 1460 1101 11159 ----
NM_005966chr252299 2121 615 488 380 ----11927
NM_006256chr172305 2129 1912 814 325 285 217 11803 ----
NM_006380chr1731661 1267 185 21003 908 --24150 3905
NM_006517chrX62061 1430 890 866 566 331 ----12274
NM_006544chr1465907 5132 4549 2438 1267 851 14613 14190 --
NM_006599chr1687464 6790 2235 1899 1355 1203 333 306 58280 7207 6563 5508 409 15602 --
NM_006609chr221924 887 --1283 1840
NM_006667chrX31047 371 56 31191 986 902 31115 942 894 --
NM_006717chr933294 562 493 --22894 272 1727
NM_007007chr1244477 1939 1146 40 1779 1989 --
NM_007106chr133783 97 32 22077 252 11825 --
NM_007114chr322512 2243 ----1167
NM_007249chr1398534 7183 6721 5886 3333 2979 2873 2270 2131 17522 38702 7606 1221 --
NM_007373chr10--21804 543 21244 486 1651
NM_012096chr332560 1469 43 13454 11380 1538
NM_012234chr363511 3257 2976 1016 593 443 --1577 --
NM_012290chr21516 1475 11105 21607 1485
NM_012420chr1032131 1441 1422 11890 1494 11829
NM_013231chr1463770 3507 3410 2764 748 207 12849 33894 3049 3023 --
NM_013255chr7137458 7394 7275 7108 6629 6296 6075 6065 5797 2570 1738 1717 535 31705 1592 236 ----
NM_014048chr1684115 3538 3464 3347 1966 1953 1322 196 14040 11248 --
NM_014157chr1654023 3641 3619 1453 67 --23687 567 23595 1590
NM_014372chr141952 1500 633 497 --11878 --
NM_014423chr564481 4271 3422 2013 1685 1101 --24949 579 --
NM_014445chr342288 759 715 377 31670 1560 270 11983 12460
NM_014456chr1041740 1339 1207 495 1751 --1555
NM_014667chr361628 1563 955 923 329 261 --21993 61 --
NM_014729chr822012 397 --1164 174
NM_014755chr244261 3227 289 63 --12968 14299
NM_014787chr162757 1942 1055 609 590 223 ------
NM_014872chr982270 1757 1578 785 663 553 243 115 167 ----
NM_014873chr174352 4163 3817 3017 1845 1279 325 --24584 4532 --
NM_014877chr17107692 7424 7326 7106 6846 6772 4774 2376 1623 92 12470 ----
NM_014906chr1754049 3498 2640 345 311 11377 1606 --
NM_014920chr613633 1977 22790 1071 2844 297
NM_015020chr1683658 3561 3215 2816 2585 2464 769 141 ----13624
NM_015026chr1273682 1543 677 519 364 302 35 ----23391 1156
NM_015035chr20106238 5913 5605 4670 2684 2608 2507 2329 786 413 --2489 287 --
NM_015039chr173378 2692 1676 1542 1111 847 254 --24343 176 13043
NM_015045chr1021869 731 --1182 1789
NM_015110chr941861 1616 488 102 --12264 --
NM_015144chr1662835 2558 2502 1041 831 793 --23090 564 --
NM_015310chr8107817 7565 5779 5073 2141 1321 1303 1114 458 299 1738 12568 --
NM_015336chr124823 667 401 135 12141 --12040
NM_015349chr633018 235 65 1812 --1945
NM_015458chr885282 5051 4365 3274 1951 1558 1551 237 1350 ----
NM_015576chr372919 2873 2515 2330 1948 818 676 --11183 --
NM_015879chr1897599 6616 5646 5486 2304 2202 723 703 350 36156 2670 1501 ----
NM_016040chr132445 919 385 ----2855 67
NM_016131chr222092 274 1934 --12315
NM_016206chr348012 7091 2110 1168 28270 638 11466 --
NM_016271chr1852305 2020 1697 420 115 11561 ----
NM_016290chr51195 ----1218
NM_016353chr852430 1920 1541 330 90 ----1996
NM_016396chr1541178 1068 1041 313 11136 --1565
NM_016620chr12988 941 ----11381
NM_017413chrX12119 1603 --12107
NM_017420chr1433434 2983 785 ----1159
NM_017610chr1561650 1566 1404 597 169 156 161 ----
NM_017637chr9119482 8582 7175 6221 3466 3399 3142 2973 2897 1398 1033 --37153 606 67 --
NM_017778chr831135 444 83 ----1179
NM_017902chr1045290 4541 1687 533 1546 21945 1357 23545 1854
NM_017944chr1112763 11143 12808 1202
NM_018121chr1073069 2989 2118 2112 1964 617 323 23084 295 1272 --
NM_018167chr142710 269 ----1674
NM_018254chr12686 206 11929 --21791 354
NM_018374chr785202 3731 3516 3424 1943 995 874 316 ----1131
NM_018638chr1275243 4194 3670 1404 1353 1102 494 --21190 870 --
NM_018948chr111283 ----11266
NM_019004chr762313 1898 847 824 598 300 12030 12195 --
NM_019050chr472207 2167 1913 1822 1535 366 301 --1590 --
NM_020177chr53507 445 48 22422 1245 12821 --
NM_020357chr32621 53 1359 11241 11218
NM_020390chr344626 3812 3509 515 ----13433
NM_020640chr32363 32 ----167
NM_020666chr51596 165 --1114
NM_020718chr1656574 6073 5999 801 273 22243 875 ----
NM_020773chr432423 350 252 --1618 12628
NM_020774chr18115805 5063 4723 4706 4557 2352 1716 1102 768 357 42 11011 14058 15721
NM_021033chr1383503 3169 2959 2177 1299 665 241 188 ----13370
NM_021038chr3--1761 21120 508 12466
NM_021045chr103700 688 43 11733 --1730
NM_021229chr1231064 978 174 --11010 11052
NM_021961chr1186863 4676 2703 2596 1800 901 886 217 16085 --17331
NM_021964chr3126534 6417 5972 5514 5420 4521 2514 1657 746 698 610 170 1914 46102 5727 2435 387 --
NM_022080chr2012287 12471 22572 434 12461
NM_022351chr833566 3422 3242 --13433 --
NM_022763chr372760 2536 932 885 538 370 347 ------
NM_024631chr111624 ----1483
NM_024641chr652686 2526 2307 832 818 --12273 1334
NM_024947chr389206 7832 6664 6188 3643 3167 1641 1483 33564 3031 2046 16059 --
NM_024989chr267487 6325 3071 2841 347 282 15034 36755 5947 1497 --
NM_025054chr823273 82 ----12868
NM_025134chr1652129 1733 1707 1035 115 --11879 --
NM_025222chr373046 2976 2564 955 795 613 600 ------
NM_030625chr1021615 253 ----1427
NM_030627chr564026 1460 1443 1303 431 107 13863 11329 11186
NM_030647chr795847 5765 5584 5482 5403 4988 4265 3993 2188 15917 25316 2052 --
NM_030648chr4104826 4617 4552 4439 3800 3707 1040 956 348 338 --12077 --
NM_030650chr263493 1479 1438 1363 55 39 --13717 2626 563
NM_031461chr821967 250 --1274 1263
NM_032217chr421039 945 ----21167 1050
NM_032373chr1054876 4608 1324 1010 261 ----25212 72
NM_032458chrX23261 1307 12211 --1600
NM_032547chr411142 --1945 11351
NM_032859chr1373545 3332 2694 1378 1126 862 711 11234 ----
NM_032968chrX23272 2619 21246 152 --147
NM_032973chrY23267 2618 21246 152 --147
NM_033224chr768057 5993 3093 3002 2702 382 21434 193 37905 5806 3214 1142
NM_033285chr884470 4288 3081 1433 1096 590 583 294 11396 ----
NM_033656chr2155969 4466 3845 2065 344 15195 1731 --
NM_080872chr853279 3093 1551 1511 1103 --13004 --
NM_101395chr2163299 3129 3102 2433 934 192 --23273 331 --
NM_138779chr131185 ----137
NM_144571chr446825 6688 5817 52 ----26682 909
NM_144599chr1565444 4106 4091 3480 1218 786 --1801 11152
NM_144982chr121729 ----1743
NM_145735chr1362838 2394 2328 2057 1768 807 12179 12450 --
NM_152622chr563499 1080 910 862 782 72 1893 ----
NM_152758chr812724 1660 12997 1345
NM_152835chr142212 2000 763 756 11911 12556 --
NM_153184chr311598 11925 --11505
NM_153262chr172939 2898 2327 506 308 243 23 --11106 --
NM_170665chr1274367 4290 3317 1273 994 501 443 ------
NM_173510chr2242402 1929 691 55 12261 --1400
NM_173808chr163870 1622 1172 934 307 72 ----14325
NM_175767chr521600 1388 11449 1416 175
NM_180989chr134899 645 404 344 1365 --1534
NM_182487chr944231 3333 3280 1065 12907 22882 893 --
NM_182503chr654534 3565 2037 776 661 --21295 192 --
NM_194247chr263955 1489 1308 1255 206 24 13333 2145 84 --
NM_194291chr852863 2217 1895 1145 506 2426 238 ----
NM_194314chr134611 1185 123 11653 --13772
NM_198581chr237063 5656 5162 --16139 1971
NM_203459chr132425 2199 2020 11828 11740 11758
NM_206853chr664081 3469 3086 1123 931 99 11086 ----
NM_206855chr686307 5695 5312 2325 2242 942 737 505 11017 1477 --
NM_207406chr455387 4535 666 330 106 1684 15202 --
NM_213589chr265493 2102 2027 1324 1228 952 13769 25539 908 --