TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-944
miRNA Sequence: AAAUUAUUGUACAUCGGAUGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr561622 738 561 480 307 215 1452 32014 1886 617 1566
NM_000084chrX95990 5319 2069 1972 1889 1734 934 743 488 36983 5958 196 1812 1841
NM_000092chr274118 3848 3814 3806 3672 1211 514 --34423 1584 477 11375
NM_000109chrX62055 2034 1968 1788 1020 27 42387 1859 1824 712 12278 11897
NM_000163chr552125 1987 1934 779 758 --41451 750 554 499 --
NM_000176chr573739 3383 3134 3010 2606 1540 576 23036 419 23662 1094 --
NM_000176chr573739 3383 3134 3010 2606 1540 576 23036 419 23662 1094 --
NM_000176chr573739 3383 3134 3010 2606 1540 576 23036 419 23662 1094 --
NM_000202chrX153864 3793 3184 3119 3025 2508 755 737 661 654 457 450 398 207 200 --31247 1237 741 1629
NM_000217chr1275297 5046 3443 1186 1168 1160 301 14002 24048 1645 --
NM_000232chr473217 2974 2905 2858 2041 655 587 2145 97 --1227
NM_000238chr72384 333 ----3393 357 338
NM_000259chr15145798 5791 5611 5472 4839 3970 2093 1485 1431 801 614 589 470 259 24392 2139 36209 2151 531 --
NM_000264chr9133379 3233 3154 2967 2618 2308 2150 1202 1183 891 521 387 374 --22465 2231 12923
NM_000267chr1762643 2531 2241 1304 962 459 --43057 2565 1348 1049 2859 660
NM_000332chr6116909 6802 6261 5809 5715 5305 4818 2685 2127 1951 1014 12824 45173 2725 2292 2227 16851
NM_000337chr5136586 6278 5778 5478 5391 5360 4885 4716 2556 2193 1465 1194 914 12072 14027 15159
NM_000390chrX123262 3139 3093 2862 2679 2533 2504 2429 1100 841 650 443 33386 3178 2544 53341 3298 3155 978 307 --
NM_000408chr2113374 2871 2557 1257 1185 886 784 724 493 425 89 11067 ----
NM_000448chr11112993 2584 2563 2228 2205 1041 801 765 713 528 469 --21259 453 --
NM_000450chr131801 1162 440 --11418 21259 445
NM_000492chr751380 1141 1096 423 206 1417 21210 302 11185
NM_000555chrX126843 6615 6267 6187 6101 6059 2396 1934 1542 1083 747 590 25336 813 77245 6145 6034 3081 1386 1212 751 37429 7355 2509
NM_000618chr12106372 4990 4504 2147 1876 1789 771 679 470 238 15613 21819 689 16607
NM_000621chr132408 246 2536 282 1263 11138
NM_000793chr14124804 4730 3145 1685 1639 1585 1570 1481 1360 943 631 605 23963 1506 13106 32052 970 351
NM_000809chr4189166 8823 8711 8637 8366 8298 7623 6384 6281 3086 2934 2706 2470 2455 2093 1252 505 110 48448 2880 2828 710 78997 8982 8571 8269 2773 2717 2289 22672 2207
NM_000813chr5235613 5595 5200 4987 4979 4699 4610 4424 4094 3799 3666 3584 1862 1827 1784 1677 1438 1301 1095 927 483 464 174 15176 55254 5143 4185 4112 298 14073
NM_000824chr46887 841 608 325 317 308 ------
NM_000826chr492216 2184 2170 2091 1900 1845 1010 747 400 --12083 31613 1596 318
NM_000860chr441516 1460 450 236 --31317 454 250 11091
NM_000866chr391492 681 592 429 401 369 288 132 71 --2623 208 1328
NM_000885chr262095 1882 799 457 213 198 2680 666 --1164
NM_000891chr1763526 3442 2555 1438 726 449 23590 168 32569 2537 557 128
NM_000899chr12114208 4045 3859 3816 3600 3292 2951 2698 1666 571 158 --34240 1719 1360 --
NM_000912chr8123482 3368 3070 2557 2436 1391 1366 1280 1253 855 787 54 13512 ----
NM_000959chr1133581 3260 2999 2953 2869 2832 2508 1205 1171 1145 854 824 224 --43669 3038 1175 743 1699
NM_001001419chr5105021 4865 4676 4583 4329 4054 3683 3247 573 125 23768 3697 24431 3211 --
NM_001001481chr8113290 3209 2977 2529 2175 1353 1232 834 750 719 249 1814 33213 3137 2299 1408
NM_001001664chr2154060 3696 3308 3119 2891 2863 2818 2719 2511 1597 1380 979 463 322 155 1918 1728 --
NM_001003652chr18128387 7658 6119 6019 5848 5550 3382 3001 2949 1157 798 243 43272 2721 1274 973 46511 1729 900 802 38110 2356 1459
NM_001003674chr18117086 6969 6876 6820 6600 5383 2624 1780 1288 915 182 22617 380 26801 1001 12703
NM_001003712chr12104031 3415 2925 2481 1606 1509 1426 876 472 464 33939 3562 483 11380 12486
NM_001003760chr683036 2997 2946 2719 2433 1343 1320 1037 23408 2960 33381 1002 732 --
NM_001004317chr6114230 4083 3957 3260 2850 2799 1674 1152 727 410 363 21582 1545 1616 --
NM_001004419chr1254639 3629 3070 687 337 13331 33803 1440 304 23902 3380
NM_001005386chr252076 2055 2002 1892 859 --11540 12246
NM_001005473chr5195592 4864 4743 4405 4340 4312 4154 2189 2133 1865 1819 1674 1647 1540 1427 857 765 618 576 --34443 2144 1662 12383
NM_001006600chr562176 2127 1787 919 639 139 1891 21796 688 22480 336
NM_001007246chr2171905 1607 1426 311 83 55 45 1663 --137
NM_001008226chr1561666 1537 1420 395 302 224 31144 315 75 21772 1645 1610
NM_001008239chr18103749 3325 2947 2888 2748 2619 1286 607 311 237 --23276 2905 1675
NM_001008393chr472357 2266 2202 2116 972 543 26 --42224 929 453 39 --
NM_001008495chr842217 2133 1630 1504 --32072 1971 1771 1841
NM_001008738chr582395 2377 2292 2146 1167 992 531 359 --22516 236 1379
NM_001009554chr464315 3107 1848 1606 756 244 --44421 4011 3335 3005 11143
NM_001009571chr751148 1080 670 467 344 178 21243 1094 21695 1066
NM_001009899chr386278 6197 5698 4936 4889 4812 4245 945 26108 4493 24635 4226 16495
NM_001009959chr282495 2454 1042 1025 752 634 293 140 12317 2893 367 1963
NM_001010861chr1102523 2388 1969 1724 997 929 895 675 559 122 1687 32770 816 113 --
NM_001010888chrX114597 4226 4046 3735 3717 3405 3269 1125 1105 1039 52 13216 43847 2923 1763 85 170
NM_001010986chrX112550 2178 2142 1935 1794 1693 840 470 408 297 236 1798 32305 2151 122 1495
NM_001011513chr4114105 3712 3432 2898 1608 1536 1105 491 456 316 106 --33904 3776 1089 1333
NM_001011666chr785903 2634 2301 2027 867 823 710 547 46205 5219 4162 136 45767 4662 2240 1068 15619
NM_001012423chr1582632 2509 2116 1961 1935 603 239 138 1116 --1160
NM_001012755chrX105013 4857 4637 4208 4120 3710 2035 1864 1849 1828 --64941 4641 3841 3719 3603 1806 15000
NM_001013620chr12248507 7913 6952 6611 6166 5904 5295 5172 2674 2646 2438 2430 2287 1941 1752 1323 1287 1238 1226 636 567 525 409 214 58060 7591 5184 2775 1347 48180 8155 5306 385 26704 42
NM_001013629chr1072081 1713 1685 1658 1315 287 257 31640 1597 1329 41996 1941 1623 1376 --
NM_001014797chr10158135 6198 6031 5788 5752 5153 2596 2476 1999 1563 1272 1016 600 531 353 58077 8071 8065 1968 558 56412 6358 2954 2130 324 25800 2468
NM_001018065chr9105406 4884 4824 4345 4187 4067 4038 4023 1768 1447 21829 878 --14565
NM_001018067chr1144992 4818 3677 3583 3437 3417 3358 1720 1644 1632 1330 1279 959 242 24467 1239 45050 4766 4308 3393 13386
NM_001018090chr1552872 2776 2448 2121 413 --1101 22541 1886
NM_001023567chr1582452 2053 2003 1994 1982 1956 239 138 1116 ----
NM_001024948chr1123422 3306 2600 2540 2477 1186 685 497 484 473 375 320 12470 21254 695 --
NM_001024948chr1123422 3306 2600 2540 2477 1186 685 497 484 473 375 320 12470 21254 695 --
NM_001024956chr11165789 5503 5459 5278 5183 3871 2171 1199 1063 890 815 690 475 384 153 80 45470 2355 1119 733 35142 4554 910 14337
NM_001025077chr1087356 6933 6753 6038 4605 2847 894 781 25087 184 56847 4632 2502 1877 217 --
NM_001025079chr3123390 3107 2994 1555 1506 1458 1144 517 297 272 184 87 --34107 3240 2760 21560 202
NM_001025108chr294022 3630 3532 3065 1474 1068 560 553 135 --34210 3830 3210 --
NM_001025233chr12102742 2621 2567 2428 2248 1980 747 528 432 368 1263 2418 402 12581
NM_001025252chr893115 2812 2600 2082 2028 1084 599 298 272 21233 449 22504 137 12238
NM_001025580chrX113038 2922 1718 1635 1537 1189 1156 1109 476 241 111 31655 1356 889 14143 --
NM_001030055chr14164388 4173 4153 3416 3202 3189 3089 3046 3001 1767 1413 691 673 598 484 100 14178 54531 4322 3005 1681 338 --
NM_001031700chr452501 1556 1015 882 861 --32441 2240 756 --
NM_001031812chr582305 2201 1741 1686 1570 777 425 282 ----1935
NM_001033045chr2144125 3913 3904 3752 3735 3582 2763 2709 1676 1168 987 933 709 239 --42988 1680 1122 766 1657
NM_001039538chr2113580 3125 3106 2849 2759 1312 1173 657 163 109 27 1548 31281 598 132 --
NM_001039547chr3158058 7956 7865 7109 6758 6269 6107 5921 5309 2366 1921 1768 1364 1284 514 36823 5175 578 46886 1936 354 334 --
NM_001039569chr2123273 2807 2719 2152 2067 1293 808 784 507 461 371 363 33302 2114 165 2443 109 1813
NM_001039618chr11155751 5616 5407 5366 5299 5100 4580 4487 4477 4408 2111 1999 1623 180 118 43820 1497 1040 748 45511 5208 2134 1144 --
NM_001039840chrX195841 5602 5265 5166 5104 4857 4815 4723 4627 4026 3964 3842 1731 1646 1445 1407 1144 326 253 14716 35529 1302 864 14129
NM_001039937chr13163696 3566 3548 3503 3244 3070 3027 2982 2869 2530 1645 1606 588 564 549 377 1668 23209 2967 --
NM_001040020chr751578 1324 359 192 180 11382 11021 11527
NM_001040152chr7124944 4764 4699 4611 4253 3774 3196 1379 810 628 284 31 --44888 4663 3752 3158 23348 1423
NM_001040284chr16185171 5098 4571 4197 4092 3871 3844 2256 2047 1712 1422 1248 776 624 556 541 335 39 --23826 2308 --
NM_001040429chr1393570 3025 2848 2818 1110 803 435 232 60 --12694 1848
NM_001040441chr1155438 5363 4791 4780 4208 3556 3480 3392 3355 3341 3324 1446 1436 1237 119 14230 24912 3849 --
NM_001040665chr7115044 4871 4747 3386 1881 1870 1299 839 647 305 217 24879 3264 55048 4990 4718 3925 365 13901
NM_001040665chr7115044 4871 4747 3386 1881 1870 1299 839 647 305 217 24879 3264 55048 4990 4718 3925 365 13901
NM_001040712chr9103369 3157 3054 2852 2574 2405 994 816 206 189 22861 828 22941 2506 --
NM_001042404chr171739 1394 1272 1225 715 449 253 ----21245 275
NM_001042533chr3103331 3042 2787 2626 2324 2184 802 652 630 490 ----23285 2923
NM_001042543chr471618 1267 1081 538 361 322 107 1446 41173 1138 580 412 1465
NM_001042550chr961984 1801 1411 1367 627 573 --41598 1293 661 607 --
NM_001042599chr2157309 7210 6558 6264 5169 4924 2938 2909 2866 2234 2225 1826 1577 1098 589 27679 144 37340 6939 2922 32750 1716 623
NM_001042604chr3154668 4530 4471 4024 1702 1588 1506 1060 893 639 477 374 332 272 103 24299 1621 44898 4240 3961 735 2776 408
NM_001042683chr661677 1326 535 451 430 251 11511 1525 1696
NM_001044385chr2123975 3733 3663 3500 3261 2812 2659 2629 498 333 221 26 11541 12732 23231 488
NM_001046chr552934 2450 2239 2215 991 12896 12868 12667
NM_001099678chr3246368 6355 5087 4759 4719 4595 4560 4490 4312 4218 4170 4036 2550 2359 2319 1998 1806 1606 1344 730 648 374 214 204 14154 35709 2440 1271 --
NM_001106chr3149800 9601 9557 9099 9059 8451 7196 6987 6462 5925 3574 3503 3231 1867 49511 9020 160 151 69067 8206 6530 6030 2408 1648 26866 2605
NM_001121chr1091691 1526 1417 1407 615 505 386 374 255 1400 ----
NM_001160chr1272785 2718 2246 1945 1853 1108 149 1310 --11931
NM_001167chrX136648 6602 6520 5081 4819 4768 4616 4451 2192 1469 590 413 77 11405 21560 1036 --
NM_001186chr21123191 3115 2768 2623 2301 2227 2133 2043 361 271 259 151 --42709 1021 398 186 --
NM_001198chr6102007 1689 1501 738 587 561 485 439 367 353 31944 1835 340 --1402
NM_001201chr4133948 3783 3758 3584 3342 3302 3089 2738 2604 1589 844 628 449 --33762 2800 720 --
NM_001204chr2227220 7194 6779 6166 5690 5586 5467 5455 5133 3060 2887 2603 2041 1666 1650 1593 1541 1424 1343 1113 1025 334 36513 4819 3009 87475 5459 2850 2434 2398 1178 1106 518 14953
NM_001233chr7102179 1817 1800 1610 910 466 409 294 277 165 12029 2896 342 21845 310
NM_001241chr2142422 2311 2283 2122 2110 2043 1945 1879 1763 1751 1499 525 509 423 22230 1664 1105 --
NM_001241chr2142422 2311 2283 2122 2110 2043 1945 1879 1763 1751 1499 525 509 423 22230 1664 1105 --
NM_001259chr7105641 5407 5260 4612 3942 3896 2048 1498 1343 572 25165 4366 46019 5567 1836 501 25830 4456
NM_001310chr12113038 2693 2629 2467 2153 2069 1868 530 504 366 357 --1755 --
NM_001432chr4143850 3813 3647 3510 3399 3360 3329 2989 2784 2734 595 483 418 74 1793 43566 2788 965 233 12707
NM_001438chr193597 3423 3388 3209 3129 3076 1355 983 123 --21119 899 --
NM_001460chr1103624 3499 3116 2873 2808 2334 2194 1310 1226 504 --43615 3073 2812 2597 --
NM_001465chr582176 2118 2064 1778 1374 387 302 173 --21920 1453 11379
NM_001527chr6134608 4594 4555 4289 3974 3881 3855 3789 1530 1390 1128 600 440 34024 1654 316 1279 2500 445
NM_001609chr1093354 2993 2945 1621 1142 1021 904 865 848 23574 918 63028 2978 1284 1146 1009 658 --
NM_001621chr7103087 3059 3023 2688 2420 1113 959 767 736 510 ----1753
NM_001650chr1894068 3622 3212 3125 2760 1594 1124 1103 155 --23460 1314 --
NM_001663chr1482484 2442 2062 1740 915 642 635 341 22533 2287 52081 1022 943 573 345 --
NM_001690chr372589 2371 1872 1675 1602 1045 973 --11606 1517
NM_001695chr874152 3914 3236 883 673 588 190 --21155 258 2778 413
NM_001730chr1381574 1553 1369 1191 1140 621 439 431 --21430 1068 --
NM_001759chr1285249 4532 4207 1493 517 396 266 179 23640 431 24183 2030 --
NM_001858chr694667 4482 4302 4272 3990 3528 1865 1457 234 --23305 658 13746
NM_001918chr1148786 8301 6448 6107 6100 5903 2958 2910 2135 1250 1194 943 898 177 27983 117 67812 7615 7470 6703 1453 102 11199
NM_001938chr171854 1488 736 677 661 591 84 --21202 764 11351
NM_001977chr441364 1293 258 107 ----2644 268
NM_002006chr4175785 5588 5366 5096 5024 4881 4743 4482 3526 1604 1597 1295 862 461 453 248 108 --95767 5401 4609 4542 3515 3506 2227 1623 1287 1867
NM_002009chr15112656 2104 879 861 833 725 583 452 384 336 101 --1281 1341
NM_002015chr1393249 2992 2559 2536 2508 1330 893 806 290 32342 1063 1006 1747 --
NM_002025chrX169227 7996 7768 7238 7136 6595 5854 3162 3117 2843 2003 1611 1546 1271 1032 673 32581 2557 1529 25870 5687 17007
NM_002033chr1184158 3910 3488 3008 2518 1611 1563 792 13399 13186 14151
NM_002069chr751870 1282 1183 576 249 --21364 698 1473
NM_002099chr451638 1371 350 254 169 22036 1982 31446 1315 688 21521 522
NM_002128chr1362604 2209 1578 730 647 386 42312 2254 579 147 31925 1754 353 12598
NM_002210chr2113510 3209 2822 2521 1391 1094 905 755 303 246 227 22603 2222 32975 2942 2171 --
NM_002214chr795504 4801 3979 3602 2268 753 422 390 66 34534 3814 939 64758 4373 3960 1713 504 47 --
NM_002270chr5134672 4473 4438 4413 4311 4262 4190 3463 3448 2018 798 439 365 55195 4398 3606 807 554 45631 5306 1357 905 15177
NM_002310chr5156482 6421 6304 5384 4912 4386 4035 4019 2162 2040 1764 1518 951 886 537 26460 4617 24264 1745 --
NM_002351chrX81647 1465 1305 620 315 261 73 38 --21569 209 --
NM_002395chr631230 1141 55 21012 353 31519 1279 84 11382
NM_002451chr973565 1236 1186 896 833 564 549 33154 626 557 43576 1117 572 174 12896
NM_002577chr373830 3769 3483 2877 1021 718 531 --54045 3280 3044 2801 1424 --
NM_002581chr9125616 5422 5279 4961 4596 4313 3549 2235 2135 2058 1295 875 35106 3590 2201 ----
NM_002594chr2072403 2159 2071 2000 1672 1666 649 --12130 22408 148
NM_002645chr1192659 2369 2195 2086 1133 895 692 613 490 13013 12026 32592 802 682
NM_002655chr8115235 4899 3704 3502 1874 1848 1363 772 538 512 469 13215 1699 11478
NM_002677chr8163055 3016 2841 2754 2691 2389 2353 2121 1132 1101 571 556 511 317 299 43 --11056 --
NM_002731chr173001 2099 1259 913 750 690 500 1878 --22475 450
NM_002834chr1263842 3445 2704 686 504 344 13606 53959 3612 1485 752 428 --
NM_002959chr164410 4274 4003 1730 1323 887 --23916 1145 21442 1341
NM_003099chr15115519 2595 2582 2470 2118 2086 1692 1659 1545 1537 901 14995 45852 2481 1915 204 --
NM_003101chr1121631 1580 1556 1468 1384 1278 1192 622 555 532 350 254 1299 1486 --
NM_003108chr277251 5952 5512 1609 1406 1130 89 24979 356 46405 6028 5173 4467 14615
NM_003112chr772950 2704 1119 1033 567 454 389 32795 1100 436 63183 3166 2847 1223 501 393 --
NM_003161chr1762953 2552 2357 2287 649 198 12270 11351 13029
NM_003203chr282474 2325 2047 1803 1740 966 359 186 2668 40 11985 22439 452
NM_003221chr672925 1526 1311 953 300 283 274 1664 22993 1158 --
NM_003262chr3195190 5177 4712 4393 4228 3406 3326 3274 2112 1792 1743 1635 1253 1101 1063 738 448 311 221 1394 54790 4346 3253 1530 1268 --
NM_003292chr172310 2082 1931 1724 805 691 685 12014 3573 247 61 11964
NM_003298chr374842 4668 1987 1933 1587 410 345 --45474 4672 2021 516 15399
NM_003342chr1793280 3182 2586 2270 1111 1060 651 333 285 1202 32711 1125 601 --
NM_003381chr66891 750 355 300 207 63 177 2849 102 --
NM_003392chr394172 4091 4046 3482 952 906 897 557 194 1179 1798 14157
NM_003412chr3103122 2977 2826 2794 2776 2761 2705 2445 1236 861 11188 13076 1412
NM_003463chr693024 2983 2767 2529 2062 1264 1185 1112 911 33367 2943 2156 11202 --
NM_003478chr1153344 3244 795 678 542 21010 949 22268 759 12704
NM_003566chr12153181 3134 3024 2895 2731 2667 2657 2193 1245 1095 1029 831 595 312 25 42970 2719 1369 695 32644 2164 2121 --
NM_003583chr1273921 3420 2458 1403 1348 980 266 13605 --11353
NM_003590chr293768 3422 3371 1521 1125 1053 821 771 644 12667 33880 2982 742 23162 677
NM_003615chr3123973 3842 3797 3515 3418 2816 2747 2728 2700 908 572 360 53835 3250 1554 1531 677 41421 1128 802 740 12439
NM_003672chr131978 1879 1476 11744 51915 1866 1711 1621 498 --
NM_003758chr1561630 1534 1373 352 243 229 11048 --21635 1473
NM_003772chr1181259 1025 1011 958 499 469 404 191 1374 1479 21078 512
NM_003884chr351374 1348 655 618 449 1282 11852 2707 119
NM_003913chr6134101 3987 3920 3584 3123 3105 2727 2711 1538 1269 1090 827 302 1683 13377 21453 1356
NM_003930chr762547 2331 2211 587 410 402 ----1246
NM_003966chr5127036 6598 5911 5294 3125 2787 2381 2245 1706 1420 1015 368 --37812 5920 2062 11469
NM_004080chr791470 1276 1138 1055 1016 543 419 412 41 1952 31510 1097 512 --
NM_004100chr672046 2035 1825 847 751 716 480 --3894 885 506 --
NM_004109chr1142180 1826 1505 746 2567 51 1687 32283 1988 223
NM_004124chr14143398 3314 3168 3067 2691 2506 2212 2193 1424 1261 1001 671 211 176 23330 1067 2896 473 11148
NM_004133chr842382 2333 1741 381 12597 42576 2561 2386 328 1771
NM_004170chr9101635 1628 1597 1458 1417 1378 1321 699 540 281 --31719 1639 1269 --
NM_004171chr11169014 8805 8311 8129 8097 7424 7066 6987 6464 5971 2997 2979 1354 1348 723 193 28982 1907 48919 7965 7302 1407 --
NM_004232chr1883291 3111 2978 2938 2394 1498 1214 251 1766 53835 2997 1356 1308 1291 --
NM_004274chr1463008 2803 2601 2354 2175 602 1970 32278 1275 844 11207
NM_004375chr1751805 1154 466 303 88 --11251 2602 114
NM_004412chr1095986 2373 2262 2116 1623 1378 1194 553 402 22210 1923 45998 5800 406 58 21912 1616
NM_004458chrX82588 2327 989 656 554 527 502 186 21957 719 12359 1600
NM_004464chr4114312 4155 3591 3444 3139 2622 1664 1640 1550 1051 620 23725 2631 14142 --
NM_004501chr183711 3295 3090 2937 2627 715 587 532 21517 1227 33861 3684 3165 13611
NM_004505chr1751945 1901 1600 1532 331 11755 21678 491 21402 142
NM_004586chrX95392 4678 4171 3686 2060 1258 1219 999 263 15262 35083 575 173 12016
NM_004612chr9134687 4239 4153 3591 3431 3110 3097 1782 1391 1162 557 475 282 14766 21844 1199 --
NM_004745chr896978 6823 6049 5830 5447 5315 5090 2529 2096 21303 371 16794 12294
NM_004795chr13101920 1733 1524 1410 1370 639 442 245 192 183 11669 41889 1841 1743 383 139
NM_004808chr10103345 3323 3286 2660 2175 1366 1288 1169 252 121 --22892 56 --
NM_004852chr181912280 11551 11543 11389 10196 9827 9815 5448 5138 5085 5053 4778 4408 4164 3918 3849 3829 3467 2791 613316 12528 10171 4389 3218 566 75499 5318 4997 4666 4129 2550 652 210102 8779
NM_004857chr14164747 4737 4454 4192 4061 3658 3610 3517 3117 1900 1379 1289 1267 1170 492 373 13928 23970 1877 13209
NM_004866chr5134806 4743 4685 4625 3686 3248 3112 1709 1369 1203 690 521 297 1311 2812 177 34608 2022 1461
NM_004898chr472596 2563 1877 974 967 488 334 --22194 1018 22117 504
NM_004956chr7113622 3197 2948 1654 1096 798 645 626 354 199 113 24580 3268 54368 4183 3482 2926 1015 --
NM_004985chr12144042 4031 3971 3809 3798 3784 3077 2767 1641 1399 919 499 474 48 --44009 3788 3001 797 24542 2977
NM_004999chr6164235 3460 3452 3192 2768 1649 1175 1047 1000 972 852 634 432 385 306 212 --43021 1743 1433 1224 --
NM_005006chr241025 919 151 97 138 2306 104 --
NM_005028chr1081892 1879 1582 922 561 551 530 521 1541 ----
NM_005065chr14103952 3624 3429 1922 1775 1654 1252 1139 769 286 11285 25402 4109 11302
NM_005086chr1261828 1558 1427 1175 713 668 --31541 1431 682 1735
NM_005126chr3101983 1945 1915 1875 1826 1624 1450 663 435 393 2835 178 12238 --
NM_005156chr9114402 4161 3391 3279 1211 861 833 802 629 270 39 --51282 1215 746 594 416 --
NM_005164chr1292264 2096 2078 2037 1639 900 889 871 739 12149 1515 --
NM_005339chr4143972 3928 2929 2915 2868 2798 1524 1478 1139 825 782 348 231 114 --12958 22639 341
NM_005358chr1371567 1399 1344 1219 405 297 199 11458 21703 606 1389
NM_005388chr941244 1124 391 357 --21723 413 11323
NM_005436chr1074141 4015 3040 3003 1571 633 429 1679 43034 1386 1375 452 --
NM_005502chr962915 2768 2625 2405 2053 369 12367 42409 2135 2010 358 --
NM_005504chr12166391 6000 5655 5584 5426 5310 5175 4905 4809 4646 4534 2647 2372 2086 1889 315 36607 4169 906 56544 4862 4241 4034 275 14185
NM_005596chr9165910 5218 5125 4857 4724 4615 3993 2559 2548 2328 2253 1930 1716 1448 235 76 1916 33977 974 137 --
NM_005665chr1104818 4191 4084 3531 3393 3163 1409 1358 1150 904 2927 56 24443 75 --
NM_005668chr564272 3783 3616 3429 2941 1182 23817 1498 34476 3455 1311 21642 619
NM_005746chr7112621 2031 2020 2008 1729 1086 930 805 646 440 339 12487 32012 1901 1890 21715 897
NM_005748chr12102932 2922 2834 2698 2246 868 715 305 168 112 22328 407 11015 1787
NM_005813chr282665 2446 2354 1920 1653 729 616 180 1717 32335 2067 915 12271
NM_005843chr251895 1848 1620 656 641 --11852 1646
NM_005857chr161200 1071 993 944 449 219 --41103 491 164 155 --
NM_005868chr7112407 2400 2374 2028 1852 785 746 703 542 456 425 1646 32288 695 530 21741 763
NM_005898chr1163234 2244 2188 924 393 296 1310 32655 2480 2036 --
NM_005941chr8124154 4021 3994 3405 3051 1578 1483 1298 1210 1158 854 698 13676 43775 3586 3384 1169 44124 4073 4012 3999
NM_005966chr272174 1971 1783 1468 322 216 51 12220 --1509
NM_005999chr151571 1388 524 365 341 11432 21212 1184 21422 1241
NM_006154chr15102419 2242 2216 2169 1940 1074 307 182 149 40 --11036 --
NM_006206chr4142965 2957 2795 2734 2621 2034 1848 1069 958 709 698 681 579 262 1355 --1584
NM_006251chr573339 3003 2793 2496 2322 2155 147 2155 93 32924 2849 2663 --
NM_006265chr871415 1324 1042 542 319 292 246 21288 1125 31515 1302 1246 --
NM_006283chr874263 3724 3587 1686 1636 1032 806 --34887 4462 84 14950
NM_006379chr761703 1606 1575 588 531 55 41762 1550 1473 1450 11714 11640
NM_006380chr17154195 3719 3232 3196 3155 3125 3084 1292 1281 1201 1141 991 841 400 376 11395 54207 3236 3039 1035 811 --
NM_006393chr1074533 4227 3838 3552 3534 743 106 14430 43762 2909 411 191 --
NM_006420chr2073324 2648 2453 2312 1194 855 312 2753 509 1873 33302 3274 636
NM_006544chr1485743 5661 5060 3956 3733 2404 619 397 35961 4688 1099 34809 2082 497 14506
NM_006547chr772041 2002 1757 1362 637 580 355 --22033 1657 1422
NM_006572chr1753350 2963 2558 2465 1143 11246 32764 2504 1219 13090
NM_006599chr16248108 8070 7167 7151 7038 7026 6685 6555 5991 5860 5703 5580 5421 5054 3257 3113 2842 2613 2488 1505 744 442 414 354 16420 27948 5094 26013 720
NM_006602chr201256 ----3261 247 237
NM_006609chr2102897 2624 2280 1146 1027 942 850 407 399 159 --12661 --
NM_006614chr3123354 3308 3266 3211 2998 2830 2766 2593 2416 2345 2313 2224 12464 ----
NM_006626chr9102722 2421 2214 2044 1976 1873 850 587 330 247 --22112 693 --
NM_006682chr7112760 2608 2078 1904 1833 975 964 675 656 618 106 52810 2511 2016 830 718 32313 2164 319 --
NM_006750chr16187772 7642 7416 7004 6745 6456 6184 6084 6046 5726 5680 5156 5058 3034 2892 2395 1820 955 --37257 6298 2300 37789 5070 263
NM_006756chr891519 1483 1465 1419 943 612 507 475 440 --2989 195 --
NM_006777chrX92676 2631 2518 2092 1947 1133 918 268 143 32105 1927 217 32955 2522 1029 12623
NM_006823chr851394 1228 1068 559 307 ----21233 1201
NM_006851chr1282401 2022 1967 1093 807 683 674 602 12885 22892 1101 12625
NM_006873chr2133428 3412 3406 2836 2604 2412 1125 1113 570 482 298 224 47 21267 909 21072 574 1435
NM_006885chr1694200 4017 3757 2855 2799 2783 1434 1276 752 14179 13163 --
NM_006902chr162792 2336 800 688 475 124 --73340 2112 2047 1309 958 757 552 1172
NM_006902chr162792 2336 800 688 475 124 --73340 2112 2047 1309 958 757 552 1172
NM_006915chrX122538 2484 2427 2352 2334 2047 1628 1615 1593 943 488 66 21694 659 31014 338 174 --
NM_006981chr982586 1160 1124 1061 582 369 327 252 12647 --13004
NM_007007chr1284694 4588 4056 3062 1883 1333 510 368 11196 24488 1702 1612
NM_007038chr21135677 4974 4633 4373 4324 4232 4010 3956 2246 1995 1577 1337 766 --75264 5065 4650 2227 2072 1800 1230 21821 1400
NM_007054chr553363 3273 577 137 92 33544 2500 1098 2464 141 11298
NM_007114chr3123348 3262 3055 2615 2381 2242 849 831 729 397 355 155 --42645 784 753 590 --
NM_007125chrY61454 1245 959 552 204 126 21212 495 21111 517 1890
NM_007137chrX175423 5357 5346 5332 4899 4756 3864 3847 3389 1601 1336 1193 1140 1133 649 418 347 --11722 23394 522
NM_007159chr371755 1516 1378 1118 609 359 236 21268 1216 21662 213 --
NM_007167chr1273 35 1180 1120 2170 151
NM_007173chr1172260 2074 1986 1972 1591 824 578 12153 32047 950 661 --
NM_007175chr863436 3421 3072 3002 2677 27 13335 23407 2884 13590
NM_007249chr13149143 8774 7595 7182 7130 7123 6564 6413 3717 3686 3515 1896 1011 984 69439 9352 9187 8457 7985 5942 68978 7544 7195 6692 2001 1847 --
NM_007347chr15123209 3051 2751 2572 2565 2094 2076 1951 1076 1038 614 404 1975 32941 311 255 13146
NM_007350chr12114595 4143 3512 3468 3074 2924 1111 743 666 597 287 2641 316 22817 417 11668
NM_012089chr151471 1046 489 455 403 11313 1193 11187
NM_012096chr343760 1073 832 320 --31428 1082 864 22669 517
NM_012120chr6133017 2825 2302 2199 2189 2066 1946 1877 1191 1068 966 657 362 --22108 667 --
NM_012164chr9167573 7051 7032 6861 6850 6754 5685 5339 5152 5041 4999 2175 1865 1568 939 323 17083 77577 5627 5605 4886 4762 2836 1056 27257 2612
NM_012214chr2106317 6254 5996 4878 4407 1859 1247 1172 1024 1015 23991 55 46239 1909 1091 162 25791 4816
NM_012249chr2103385 3317 3214 3138 2307 1432 1416 843 808 259 --23077 2290 11143
NM_012262chr1145273 5007 4841 4388 4179 3987 3961 3720 3294 3270 3242 1947 1433 1305 --44631 3494 3470 3285 21169 1006
NM_012281chr75912 692 568 552 207 12313 21777 747 11661
NM_012287chr3114256 4053 3774 3345 1829 1792 1605 1116 922 654 525 1163 44533 3939 3741 2886 11221
NM_012309chr1153358 3261 1817 1709 726 --24189 1697 24844 1838
NM_012382chr5194454 4429 4115 4087 3880 3127 3082 2994 2937 1798 1645 1622 1346 1214 719 687 630 312 191 --32819 1660 320 23006 965
NM_012465chr1083398 3379 3291 3026 2155 1316 1198 1177 --33122 2585 1306 --
NM_013231chr14104231 3986 3251 1624 1342 1111 917 452 422 135 22844 1171 11309 --
NM_013255chr7207136 7120 7010 6730 6713 6504 6468 5796 5475 3352 3218 2699 2431 2423 2251 1986 1652 839 705 522 28218 3296 78741 8006 5787 5715 2307 2045 778 16742
NM_013261chr483552 3515 3195 2916 2637 1345 1052 221 11222 13237 23414 694
NM_013374chr382879 2691 2299 1162 1043 599 458 128 12200 1833 --
NM_013381chr12112410 2395 2366 2127 2101 1838 1793 1701 1572 509 250 12203 12301 21583 600
NM_014011chr251987 1737 990 874 821 32097 1655 923 1929 --
NM_014016chr361470 1376 1088 471 324 209 31168 1126 228 11186 --
NM_014021chr1163419 3283 2680 2605 2524 2255 2167 2132 1299 1177 1053 1029 942 781 705 353 1511 2991 980 12557
NM_014028chr683181 2809 1104 1025 786 643 499 491 22495 469 1682 --
NM_014109chr85911 811 509 229 117 --2368 242 1309
NM_014112chr8135504 5134 5097 5048 4861 4849 4669 4548 3711 1521 1026 447 281 --45352 5282 1346 1273 34474 3851 1545
NM_014331chr4187852 7056 6949 6855 6354 6077 5653 5536 4898 4828 2880 2651 2135 1971 1960 1782 1774 932 46037 5097 4917 449 56115 3001 1995 1215 975 12551
NM_014423chr5155618 5110 5073 4396 4369 4270 4067 3718 2068 2041 1719 1519 1503 1191 147 34120 2052 979 21646 109 --
NM_014584chr1471461 1381 1167 1097 324 216 205 1408 11033 11021
NM_014636chr944321 3943 1599 1324 --11309 24326 3951
NM_014670chr291606 1449 1342 1093 497 447 355 285 279 --2436 371 --
NM_014674chr393693 3252 2764 2745 1053 877 713 628 210 --34015 3214 3042 13240
NM_014701chr15113413 3380 2890 2847 2772 2735 2338 1341 1150 1078 674 21021 553 13219 12570
NM_014702chr672782 2769 2389 1069 889 823 631 22246 817 22403 604 1155
NM_014717chr191831 --1739 2687 129
NM_014787chr1112673 2478 2326 2039 1924 1889 1843 1725 586 432 379 11970 ----
NM_014810chr173549 2891 2679 2645 1425 482 390 12436 31237 921 851 11080
NM_014848chr1552843 2459 2101 2006 1977 2686 618 22649 2228 12725
NM_014873chr1134789 3560 3530 3483 3327 3312 3147 3112 1931 992 763 713 180 24731 1147 13418 --
NM_014877chr17157492 7287 7213 5896 5888 5877 5321 4873 4767 2862 2397 2131 1571 568 388 --37810 5900 2045 --
NM_014900chr25943 920 908 900 172 --4471 279 252 182 --
NM_014904chr1084061 4001 3563 3049 2579 1274 1068 27 24048 2734 21534 969 --
NM_014905chr23402 284 233 --11900 3535 253 56
NM_014906chr1783856 3409 3315 2796 2680 2555 1618 1127 13109 33981 3684 1035 13777
NM_014920chr6103466 2960 2819 2745 2599 1404 1378 616 383 352 1120 23766 3056 --
NM_014932chr371736 1727 1560 1549 626 391 221 1667 21887 771 1758
NM_014946chr2103133 2646 2580 2502 2272 2077 1934 409 304 188 1975 31160 413 308 11014
NM_014950chr1461535 1185 708 561 515 52 --21554 411 31644 1514 1259
NM_014953chr1344387 4222 4163 892 12927 33750 214 119 1897
NM_014982chr14125060 5002 4788 4262 4122 3789 3366 3302 1733 1492 1175 818 --55155 3793 1898 1117 375 --
NM_014988chr4102660 2539 2369 2217 1957 1910 546 514 334 244 12623 ----
NM_015020chr1693923 3865 3581 3287 2904 2761 2480 852 816 ----23437 3368
NM_015026chr12204777 4382 4348 4225 4015 3720 3303 3236 1560 1532 1521 1493 1361 1004 767 631 565 533 323 96 21569 239 33544 760 151 11397
NM_015071chr576529 6337 6173 5148 5064 1220 353 16328 --25960 5153
NM_015076chr6104256 3931 3881 3650 3140 1716 1703 1174 681 408 --43693 1264 1233 884 1749
NM_015192chr2082998 2939 2403 2387 2116 990 818 800 22146 1906 52957 2741 1208 837 383 --
NM_015206chr15123558 3243 2903 2832 2471 2398 1430 1325 1274 1049 1041 1031 --13546 12954
NM_015275chr1272192 1985 1935 1792 1527 1442 327 21485 358 22035 1491 --
NM_015310chr8148363 8262 7666 6905 6569 6058 5723 2629 2386 1996 1545 1491 768 194 25178 1904 48130 8044 5854 122 27856 6148
NM_015313chr11104552 4532 4208 3742 3497 3031 1641 1611 1428 1383 24043 900 --13079
NM_015336chr1271922 1668 954 891 874 674 554 12168 42374 940 636 222 --
NM_015347chr1292885 2805 2739 2591 2078 1812 1021 651 236 11066 32241 2120 1187 1171
NM_015352chr2073970 3585 3423 3341 3291 1096 357 13251 --13230
NM_015394chr1292295 2201 2034 1801 1734 1682 626 404 373 --42436 1720 885 224 1701
NM_015446chr171439 1203 1194 576 425 384 51 21350 351 41099 1053 316 88 --
NM_015455chr573321 3143 3007 2886 2580 616 454 13679 42571 1306 516 108 --
NM_015458chr8105130 4876 4508 4364 3361 3331 1410 1308 1298 158 --44548 4483 3614 531 13606
NM_015560chr3122742 2653 2452 2327 1893 934 822 759 511 246 240 132 --22571 2071 12909
NM_015564chr543190 763 622 459 1265 11089 32947 1401 716
NM_015565chr2192214 2092 1823 1687 1544 765 499 383 148 21762 1748 1769 12131
NM_015569chr1134023 3362 3340 3021 1872 1819 1629 1465 1292 1041 776 466 348 23849 3472 34514 3389 427 24038 1250
NM_015713chr8112953 2727 2661 1258 1188 606 479 464 356 158 47 --43269 2665 746 515 --
NM_015878chr871957 847 539 198 182 169 128 --32135 720 78 --
NM_015879chr18128064 8023 6201 5521 2938 2692 2391 1889 1876 851 327 288 11845 1545 --
NM_015886chr8255774 4959 4757 4686 4554 4541 4479 4321 4053 3573 3546 2280 2192 1343 1116 898 818 756 638 568 530 430 424 251 242 1769 33814 572 32 11956
NM_015888chr1103210 2963 2706 2573 2429 2174 651 599 358 277 22937 838 63378 3367 3345 2861 914 218 --
NM_015906chr1134618 4575 3811 3564 3245 3135 2975 1793 1665 984 309 275 164 24556 3219 44746 4244 1900 246 --
NM_016009chr1134680 4147 3971 3909 3515 3208 1876 1626 1446 1411 850 763 384 23898 3892 1545 --
NM_016018chr8102722 2115 2014 1979 1895 844 726 355 98 82 --2972 648 --
NM_016040chr1152714 2555 2124 2093 2066 943 900 885 859 824 722 529 446 167 127 12502 ----
NM_016072chr12122341 1985 1943 1842 1817 1702 1661 962 882 844 822 244 ----11651
NM_016075chr1333157 827 586 32430 2130 692 42934 2322 2274 522 --
NM_016121chr171051 1015 988 719 413 161 148 1834 122 11183
NM_016132chr15153143 3007 2710 2490 2128 1238 1142 938 644 620 555 379 282 161 75 --2716 596 32928 2558 1082
NM_016144chr55661 645 600 520 497 --3695 649 593 1219
NM_016206chr3198798 7339 6916 6311 6182 5745 5546 3000 2923 2869 2184 2016 2001 1986 1927 1757 1730 1623 763 16212 67909 6946 6378 5611 3473 1183 28803 5750
NM_016217chr6133680 3465 2860 2739 2380 1287 1265 791 691 595 565 453 21 --42779 1064 1022 894 13589
NM_016248chr1383710 3100 2892 620 381 323 168 85 13942 23847 1588 23764 868
NM_016255chr672349 988 783 606 483 367 87 11041 23326 230 12761
NM_016356chr672853 2844 2306 1162 793 746 465 41064 1036 184 77 42086 2076 869 351 --
NM_016396chr1582461 2269 2229 1177 549 416 332 138 ----1143
NM_016442chr562099 637 592 446 204 170 --52332 2103 1515 731 535 1285
NM_016530chr1554119 3797 2785 1092 780 --13529 21497 663
NM_016531chr483664 3394 3261 2673 2585 1405 972 427 --33155 2735 1505 --
NM_017420chr14123816 3419 3073 2836 1547 1445 1423 1127 828 385 317 290 23166 2547 23349 832 23374 672
NM_017628chr4195269 5163 4808 4783 4585 4329 4184 3877 3862 3520 3211 1931 1773 1602 1468 1278 1047 410 133 13996 45175 5064 3658 721 14098
NM_017633chr6103610 3222 2792 1466 1243 1193 1111 543 465 119 --13505 1876
NM_017637chr9239435 8177 8037 7742 7133 7009 6499 6128 6078 5965 5849 5720 3732 3510 2992 2566 2414 1756 1409 1231 640 462 219 39296 6518 2036 47554 7301 1911 358 --
NM_017643chr1722697 1130 --23106 345 22359 681
NM_017644chr3165146 4000 3275 3260 3144 2031 1987 1944 1812 1802 1553 1478 530 181 117 108 11597 34294 1685 121 --
NM_017645chr963065 2718 757 572 356 272 21971 616 2640 556 11206
NM_017650chr765851 5201 4658 1866 194 97 12137 25762 2399 15455
NM_017658chr14134332 3978 3642 3347 3179 1592 1361 1323 1132 875 375 197 24 34650 3138 1672 23016 1327 --
NM_017769chr14133041 3012 2983 2905 2871 2643 2627 2321 2284 1212 1062 947 210 --12104 --
NM_017770chr632992 684 439 --12587 22903 2359
NM_017801chr331781 876 206 22490 913 32380 296 210 1818
NM_017813chr8105760 4719 4618 4148 4117 3999 2250 2209 833 621 35785 5679 4669 44277 3758 895 636 --
NM_017824chr1072678 2344 2232 2170 2143 843 427 22603 1691 1679 1528
NM_017919chr9125342 4760 4395 4274 4026 3674 3643 3599 1940 1710 1190 553 21800 752 25321 4582 13660
NM_018017chr1082528 2118 1913 830 692 575 441 401 --21917 782 22404 1863
NM_018036chr1494446 3663 3583 3573 1091 798 663 283 181 11679 1135 11795
NM_018084chr273110 2771 2515 2356 2201 1228 909 1959 21328 981 --
NM_018098chr341011 469 220 202 2927 84 31002 843 259 11108
NM_018133chr382215 2111 2004 1875 1396 837 223 170 2742 334 3827 807 160 11892
NM_018227chr4103148 2883 2397 2263 2054 2005 1153 1111 456 427 33123 2635 1987 43002 2129 1227 1161 --
NM_018312chr1161764 663 580 294 285 244 1304 1324 1726
NM_018323chr471826 1466 1220 687 555 263 64 21752 290 --21528 425
NM_018330chr1071708 1641 1559 1405 1399 1306 1299 31572 1509 267 41751 1563 1409 1292 --
NM_018351chr12114731 4668 4449 3114 3039 1774 1118 970 890 868 322 1958 ----
NM_018362chr1173804 3693 3109 2552 1148 942 726 11472 73721 2930 2826 1490 1359 1000 86 33059 2875 2621
NM_018364chr1164094 4004 3978 3793 3407 2907 2874 1207 1179 855 811 753 668 213 108 59 --32837 2784 2503 --
NM_018374chr7165111 5010 4962 4729 4653 4333 3648 3327 3290 1169 1081 677 603 351 333 180 25118 4370 34916 4352 3769 33965 3747 293
NM_018440chr8178599 8491 8367 8294 8241 7834 7808 7576 6124 3200 2756 2417 2165 1851 1814 1467 1348 38672 8644 6061 48195 5297 3304 1156 --
NM_018566chr1105005 4800 4705 4492 3808 3346 3202 1430 1199 1016 34592 4552 1744 24762 1119 --
NM_018638chr12115354 5242 5072 4874 1989 1188 868 742 512 265 168 21273 1110 --23765 1061
NM_018841chr1113656 3163 3104 2739 2552 2503 907 789 747 660 128 1288 23019 3011 11549
NM_018947chr7134394 4289 3685 1695 1454 1264 1136 702 644 516 484 264 196 31162 853 249 --1925
NM_018970chr7163153 3069 2825 2756 2582 2437 2266 2206 2200 2192 1938 1233 1190 993 798 266 22675 211 1147 --
NM_018976chr12102699 2368 2167 897 846 726 688 651 543 337 --21798 636 --
NM_018999chr10114819 4768 4075 3776 3468 1689 1567 1164 499 452 438 34969 3596 923 24652 3153 --
NM_019022chr1882993 2737 2436 2423 1284 628 508 369 --33233 3114 2162 --
NM_019050chr471716 1689 1600 1572 300 255 35 1674 21506 345 --
NM_019063chr282320 2164 1493 911 896 756 241 138 --11747 21868 862
NM_019083chr161392 1289 1108 665 193 97 21101 310 11371 11575
NM_019593chr20102899 2653 2421 2415 1177 1055 670 230 186 118 21967 398 12273 --
NM_019596chr2192809 2297 2216 2133 1975 1875 1865 765 382 --22352 2268 1781
NM_020147chr1551070 1039 174 122 97 160 2901 387 1997
NM_020199chr58856 522 513 501 455 437 160 31 --11275 --
NM_020297chr12133071 3001 2816 2805 2305 2276 2230 1363 1107 875 781 503 37 13632 11417 2790 738
NM_020341chr2081943 1890 1670 736 517 471 463 447 21550 1534 2586 50 --
NM_020390chr3134850 4663 4456 4065 3831 3627 3577 3430 3262 1941 877 187 159 --11475 34932 4800 3028
NM_020432chr742055 1624 651 275 --41417 878 601 289 --
NM_020456chr1362296 1794 767 696 665 405 1783 2776 597 --
NM_020466chr683683 3179 2010 1938 1711 1261 909 645 1631 54431 4341 3817 1833 1569 --
NM_020647chr862275 2052 1980 1921 1519 267 --1271 11416
NM_020734chr1252915 2768 2723 2652 1164 1246 12890 22793 2312
NM_020751chr1351261 1170 877 135 87 196 --21302 371
NM_020771chr651550 1354 1146 596 246 1270 2516 58 1970
NM_020772chr17188328 7463 7301 6986 6848 6699 6492 6289 6119 5909 3442 1913 1869 1217 1095 866 586 126 2729 167 48265 7502 5951 468 2711 194
NM_020774chr18235938 5804 5464 5387 5296 4905 4874 4750 4662 4618 4566 4109 2258 2123 2111 711 600 517 342 310 236 126 107 26218 495 35405 4996 4878 11424
NM_020809chr1162266 2064 2012 1629 479 48 --32028 1953 143 163
NM_020871chrX82517 2281 697 594 374 313 251 31 1815 32236 1607 97 12427
NM_020917chr19153390 3313 3136 2532 1581 1541 1518 1245 1196 1084 977 546 410 320 187 1398 43271 2762 1510 1234 --
NM_020918chr1063291 3172 2991 1224 492 401 21278 1258 33426 2349 450 21201 680
NM_020921chr1483253 3236 2973 2647 2383 1415 1189 497 33243 752 133 33635 3348 457 --
NM_021038chr3103128 3001 2489 2334 2146 2134 1133 526 409 370 22523 2163 11223 --
NM_021083chrX123379 3345 3040 2804 2740 2600 1413 1121 1057 757 402 70 23104 964 11455 --
NM_021191chr12162404 2327 2229 2162 2027 1912 1632 1020 791 732 588 510 482 396 222 52 --32504 2252 118 --
NM_021252chr1092113 1635 1307 768 457 444 274 256 105 --12117 1629
NM_021255chr14113940 3705 3172 3105 2807 1555 1433 1424 1135 981 726 32997 1096 813 32530 1248 247 21186 886
NM_021813chr6105560 4972 4540 3978 3928 3720 1696 1053 1023 840 2995 183 13671 --
NM_021815chr283106 3020 2877 2696 2516 2410 2315 232 1491 22899 2394 11997
NM_021914chr1442271 2229 398 68 32169 1720 1538 32233 2095 1708 --
NM_021960chr141087 610 577 439 1795 122 21044 634
NM_021960chr141087 610 577 439 1795 122 21044 634
NM_021964chr3186521 6461 5983 5014 4831 4387 4244 2215 1875 1434 1390 1368 1016 769 595 528 141 24 45813 5112 2007 1120 24277 342 16576
NM_022049chr141654 1584 1259 736 --21575 1566 11740
NM_022130chr581480 1466 1332 1098 931 586 103 81 11176 --11103
NM_022351chr883041 1386 1065 923 767 688 653 306 --1833 12892
NM_022444chr761668 1304 762 693 519 34 2786 680 2277 54 --
NM_022459chr13116358 6047 5878 5557 4720 2259 2206 1867 1569 637 624 13944 24983 1201 11135
NM_022483chr54764 452 432 118 3563 484 48 --21422 664
NM_022484chr761428 1293 1121 1056 355 318 --1359 21147 145
NM_022763chr342382 912 617 600 --22903 355 22080 743
NM_023016chr262588 2424 2342 788 552 353 --22579 1038 21019 969
NM_024345chr9145769 5587 5203 4780 4536 4040 4022 4013 2106 1906 1465 697 572 554 14706 45778 5549 4986 4000 --
NM_024423chr18143995 3630 3609 3281 2933 1644 989 885 777 574 491 311 271 215 --43360 3092 969 167 24216 3418
NM_024524chr3103186 3163 3084 3030 2756 2570 2510 2409 1000 926 12989 32399 2244 930 --
NM_024665chr394697 3948 3533 3463 3266 1755 1599 1402 1295 24508 1563 44600 3449 1515 824 --
NM_024721chr862620 2612 1775 903 723 399 --32664 791 117 12180
NM_024761chr995310 5239 4976 3817 3620 3297 1431 1223 858 23788 882 35131 4980 632 11439
NM_024834chr1091592 1410 693 640 278 234 94 48 25 --12010 1220
NM_024884chr1473366 3044 2944 1488 316 153 137 --34426 329 157 --
NM_024947chr3229589 9467 8646 8462 7942 7764 7046 6716 6564 6359 6339 6328 6038 5940 5908 3817 2769 2254 1851 1789 1366 288 31881 1168 186 139155 8030 3438 3339 2742 1569 1212 1085 1005 444 349 341 165 12259
NM_024949chr4114945 4784 4696 4680 4445 3699 3611 3523 1962 1077 184 14775 33505 3493 1091 13393
NM_024989chr2278187 8023 7967 7764 7441 7404 7394 7131 7109 6788 6656 6234 6202 6190 5809 5769 5596 5277 3155 3142 2636 1704 638 420 281 209 29 27995 7713 48157 7879 6432 2609 37238 7225 5798
NM_025054chr8124226 4174 4145 3733 3694 3516 3456 2915 1326 799 273 107 12686 13298 13885
NM_025134chr16132523 2408 1787 1732 1690 1023 1009 848 829 750 385 359 246 --21769 410 157
NM_025146chr372506 2410 2331 2294 1059 857 181 --22202 298 22336 572
NM_025191chr173353 3180 2928 2839 2782 2314 574 43522 3504 3036 2345 13162 --
NM_030621chr14114160 4038 3255 3218 2757 1613 1216 1053 897 792 275 13012 54231 3849 3764 976 302 13643
NM_030627chr5154122 3951 3894 3726 3495 3440 3302 1553 1442 1359 1153 1098 702 648 363 53714 2999 2988 2927 618 14087 23101 2902
NM_030648chr495582 5446 5401 5393 5171 4994 1172 1115 468 15094 43966 2129 1863 909 1306
NM_030755chr14102805 2737 2016 1107 812 711 377 269 183 32 22829 2675 1211 22144 1933
NM_030791chr1481749 1596 1571 1542 1370 388 338 211 21473 504 21153 715 1117
NM_030806chr1119331 8098 7139 6536 6119 2948 2708 2599 1734 1625 1242 1861 49453 9068 5727 3766 17770
NM_030816chr193584 3279 3141 3071 2711 1424 1387 512 131 --43547 2424 520 231 12716
NM_030945chr5152676 2624 2607 2494 2421 2267 2007 1850 1836 921 617 605 263 194 151 --22503 1970 --
NM_031271chr8101413 1371 1105 687 677 453 400 378 253 149 11533 1663 1652
NM_031296chr462735 2472 2261 1907 1857 356 --32720 1880 1729 32576 1912 1755
NM_031435chr1283268 3146 2559 2343 882 678 441 305 160 43477 2163 708 564 --
NM_031483chr2063381 3192 3086 2854 992 978 13581 --12239
NM_032047chr382427 2092 1827 1635 1536 943 889 868 11800 1330 12402
NM_032121chrX72654 2634 2518 2509 2115 2108 633 12065 12129 2206 129
NM_032160chr18124007 3464 3372 2984 2911 2893 1682 1616 1547 1533 720 34 ----22777 1216
NM_032208chr263669 3532 3481 3107 2449 197 13546 --23248 2934
NM_032228chr11173516 3119 3108 3076 3042 2700 2509 1380 1254 1224 1087 1075 993 610 533 410 339 ----11286
NM_032373chr10105946 5840 5030 4888 2194 2111 1943 755 595 278 11636 75074 4854 4845 4816 2164 1540 1140 24973 431
NM_032439chr1081628 1430 1354 1235 670 419 331 204 --11358 11199
NM_032440chr1072598 2085 2011 1139 736 600 83 2588 570 --11020
NM_032446chr583445 3363 3085 1325 1291 942 662 519 --2882 842 1815
NM_032457chr493866 3603 3536 3452 2830 2794 1131 391 308 11188 12471 --
NM_032466chr851685 1364 1356 1094 439 11298 21380 1077 2393 336
NM_032491chr1241244 935 427 36 --21272 1071 144
NM_032582chr1741913 1623 1555 171 11767 21686 502 21425 154
NM_032833chr152548 2117 837 785 190 12638 22608 483 1842
NM_032859chr13103710 3513 3494 3234 2719 1508 1497 1398 1355 49 33718 3294 2910 32632 2556 152 12971
NM_032873chr11114562 4039 3677 3588 3278 3208 1745 1605 1361 1156 1098 14514 22913 109 --
NM_032968chrX53867 3234 2924 1671 1663 53636 3584 3379 1625 1170 23172 780 1158
NM_032973chrY73859 3229 2919 1665 1657 1634 429 53628 3580 3374 1624 1170 23167 780 1158
NM_033211chr572095 2017 1659 582 559 353 298 --2429 284 11753
NM_033224chr7177049 5984 5927 5659 5501 4978 4940 3212 3099 2722 2164 2091 1819 1290 577 308 152 26012 2596 87311 5505 3162 2812 2235 1868 1518 771 --
NM_033364chr351243 773 497 168 57 --3159 149 49 11259
NM_033428chr9102077 1808 1555 798 682 486 390 332 317 284 1382 ----
NM_033505chr2186691 6596 6512 6148 5480 5299 4985 4273 4231 2689 2642 2113 1995 1646 1461 641 548 131 46738 4939 1361 672 46767 5598 2646 1101 1479
NM_033656chr21105795 5097 4944 4781 3984 3808 3702 2305 1815 1210 1484 44338 2318 1170 691 24297 2165
NM_052832chr8102984 2812 2717 2575 1945 1849 1031 809 398 359 21922 1199 32616 878 564 --
NM_052879chr12143249 3184 3020 2964 2781 2745 2556 1626 1522 1513 1344 1142 950 254 12891 32929 1084 583 13304
NM_052885chr12194971 4298 4207 4181 4113 3917 3356 3302 3272 3160 3063 3056 1945 1415 1324 1078 1043 839 263 33732 3026 328 44992 4259 1001 227 --
NM_052932chr11142416 2356 2119 1704 1685 1661 981 772 739 709 691 600 498 101 --32373 309 72 --
NM_052954chr2192182 1835 1742 1645 622 287 269 263 117 --1370 --
NM_058170chr1101583 1510 1459 1291 1263 1016 630 482 289 271 --21538 1386 --
NM_080832chrX81820 1735 1522 1373 1178 448 317 171 ----11355
NM_080867chr14104781 4141 3314 1945 1344 817 511 454 381 26 24579 1967 44507 3124 1610 863 33336 1622 1112
NM_130809chr5103001 2428 1204 1186 1112 1079 562 547 395 86 11117 42732 2718 2588 731 12895
NM_133329chr291797 1632 1500 1194 1179 740 543 419 200 --21685 1330 21289 267
NM_133478chr272558 2433 2211 1735 1723 1589 511 ----22216 385
NM_133493chr6114652 4207 4141 3841 3396 3332 3221 3029 2923 1264 1135 --43885 3502 1347 1239 --
NM_138286chr19144393 4384 3728 3693 3526 3429 2687 1624 1604 1575 1454 807 606 61 34243 4112 4091 24366 2763 1624
NM_138459chr683246 3130 2994 2894 2690 2425 447 117 12714 21249 400 13050
NM_138468chr2116215 5849 5582 5517 4363 4069 1825 891 763 634 455 32100 996 688 26191 309 --
NM_138731chr14144147 4118 4086 4045 4032 3299 3238 3162 3009 2753 2713 643 623 573 21055 1002 23585 1574 1734
NM_138782chr5112430 1909 1826 1796 1594 1535 1507 597 548 202 172 12321 2360 184 --
NM_144567chr172687 2647 2139 2052 526 333 179 12149 22517 449 12482
NM_144571chr4136523 6464 5298 4993 4626 2574 2468 2313 1865 1736 1651 760 418 --15018 12367
NM_144578chr14185548 5443 5259 5187 4651 4629 4593 4470 4120 3869 3591 3494 2040 1925 1273 1148 720 445 34812 3692 2082 42178 866 801 271 34806 3707 537
NM_144632chr252071 1548 801 451 297 ----21729 397
NM_144664chr11102084 1968 1820 1705 1644 1593 858 307 246 140 11874 62254 2122 1784 1670 990 949 --
NM_144721chr462781 2685 1112 289 134 80 21009 181 22756 1058 --
NM_145257chr1123707 3688 3635 3573 3326 3065 2999 1551 1326 1257 1179 231 34174 2709 2696 34126 3299 682 --
NM_145307chr10113874 3765 3749 3439 2916 1676 1503 1436 1108 1001 73 34666 4063 82 2868 347 44535 3612 3444 116
NM_147128chr781444 1337 1202 1178 1113 1061 488 272 --11140 11653
NM_152261chr1272468 2191 1891 1798 915 544 453 12094 32528 919 422 11881
NM_152309chr1061635 1619 1498 312 128 65 --21955 458 21832 1660
NM_152400chr492134 2015 1806 1487 594 520 454 347 49 1525 11872 --
NM_152407chr542817 919 877 800 22173 2077 32662 2429 2150 22654 943
NM_152418chr881924 1828 1587 1461 1387 736 610 159 --21407 1352 1259
NM_152624chr5137328 6014 5802 5320 4860 4693 2774 1739 1663 940 406 370 299 26279 1979 56809 6214 2646 2312 1812 16786
NM_152636chr1162867 2813 1194 1168 892 761 22950 900 22970 1246 1937
NM_152641chr1272864 2791 2725 2696 2514 2237 938 12271 32949 743 446 --
NM_152754chr7163772 3724 3676 3513 3437 3273 3226 3064 2617 1405 1385 1091 980 931 792 124 33881 2637 2382 43530 2994 298 79 13816
NM_152756chr5104300 4216 4072 3925 3819 3032 892 395 337 219 12783 21747 380 --
NM_152758chr882987 2516 2394 2184 2065 920 455 367 42882 1195 1113 264 --12907
NM_152774chr782746 2715 2470 1690 996 512 452 265 52296 2213 1041 478 319 42335 2249 354 211 --
NM_152835chr162914 2455 2181 2016 1812 1118 --32908 2782 2691 32051 2044 228
NM_152903chr1392795 2605 2437 1938 1140 893 478 166 145 11864 1209 1365
NM_152996chr182026 1776 1663 1605 1316 740 243 92 --31722 441 161 1112
NM_153207chr1283391 3263 2507 1190 1073 796 500 142 --11095 13509
NM_153226chr1081211 1149 1017 968 477 448 311 299 21130 461 11089 --
NM_153262chr143228 3204 2933 407 13031 --22821 2662
NM_153332chr883244 2988 2765 2680 2618 2166 562 258 12729 32699 982 411 12253
NM_153346chrX81746 683 515 411 362 356 276 125 11573 2584 572 --
NM_153689chr2122362 2325 2068 1860 1830 703 585 347 246 158 84 73 11950 22002 1987 1384
NM_170710chr4123154 3030 2889 2738 2571 2226 1961 1286 365 266 216 179 --32637 792 406 12716
NM_172070chr262226 2149 873 523 485 173 22199 463 41767 1576 635 292 --
NM_172071chr1177493 7147 6607 6542 6392 5343 5277 5267 5256 5016 2728 2487 1294 1058 417 408 174 26230 5102 77389 6968 6009 5888 4625 2469 1114 --
NM_173468chr4155989 5707 4970 4813 4426 3905 3860 3799 2123 2029 1864 1580 1303 513 270 --34950 3921 832 26097 5055
NM_173510chr2282851 2296 839 700 677 530 454 111 42670 2281 729 364 11832 --
NM_173519chr871953 1905 1791 1597 1372 1278 467 --51728 1612 1473 1327 480 --
NM_173582chr11146317 5986 4939 4541 2264 2110 1918 1810 1048 760 661 398 346 219 32400 1893 1836 45655 4274 1211 202 --
NM_173644chr2092045 1951 1821 722 698 624 421 411 239 --21895 1787 --
NM_173808chr1114120 3769 3364 3265 3103 3015 1621 1006 867 627 469 --33773 3478 1518 11417
NM_173825chr3132477 2377 2335 2185 2158 2052 1223 1035 686 639 541 347 266 --12176 --
NM_173829chr5156230 5668 5114 4527 4282 3992 2226 2215 2184 2159 2092 1991 1166 975 394 11983 45575 2265 2167 1998 46127 2013 1935 682
NM_174916chr15102330 2133 1628 1589 1460 816 732 589 415 255 12163 --11477
NM_175056chr361911 1564 1527 1498 276 148 11676 22211 626 21487 1406
NM_175876chr172641 2602 2056 1926 1039 873 92 32118 1978 1972 ----
NM_176815chr362905 2671 2348 2142 1948 1823 1106 22836 2675 12256
NM_178011chr1083200 3147 2752 2330 2130 758 590 365 22589 192 33046 2334 993 --
NM_178140chr532681 2043 445 --12764 22048 610
NM_178505chr1073665 3181 3157 2720 2624 754 227 --196 23515 1242
NM_178509chr17133966 3900 3633 3621 3238 2982 1546 1339 1192 403 350 302 217 2285 249 ----
NM_178566chr971857 1578 1244 1200 301 149 65 1723 2692 291 11488
NM_180989chr1382473 2417 2131 1992 1972 1891 358 343 1841 22368 962 1372
NM_180991chr5112656 2644 2607 2600 2504 2119 758 748 714 549 494 --22407 2266 --
NM_181705chr5155756 5595 5486 5447 5066 4759 4295 4228 3664 3608 3505 956 667 521 403 35582 5257 182 11381 14238
NM_181706chr1162210 2075 2048 598 437 189 2356 170 12015 11743
NM_181723chr872084 1803 1670 1559 1416 777 522 --31687 1505 363 --
NM_181782chr692195 2043 1743 1696 1601 1592 768 627 371 ------
NM_181783chr1271980 1972 1950 753 621 591 327 --42008 1422 448 311 --
NM_181787chr851568 1546 1246 630 372 1384 23696 403 --
NM_181836chr582440 2367 2286 2257 2144 1998 582 239 22554 1831 32612 1932 714 --
NM_182485chr483669 3297 3221 2309 716 545 532 411 23441 2329 73718 3690 3242 3125 2337 1459 390 --
NM_182503chr6185613 5581 5403 5122 4894 4876 3826 3749 1907 1831 1777 1521 1423 1407 1318 1246 879 660 23533 516 14773 23831 1993
NM_182515chr19146601 6595 6586 6115 6075 5868 5412 4995 2609 2167 1599 724 563 396 66391 6268 6252 6049 5350 1540 32437 2285 229 --
NM_182975chr151162 1057 859 847 311 --21049 994 2361 28
NM_194285chr1172460 2421 2413 2402 1351 827 368 13254 1831 13286
NM_194291chr892862 2461 2278 2160 2116 2029 915 499 493 22399 373 21092 114 3773 734 51
NM_194314chr1225422 5308 5079 4569 4562 4114 4013 3747 2265 2259 2190 2158 1894 1819 1723 1676 1546 1296 658 646 552 427 35216 4156 1121 35426 4581 3644 23722 3530
NM_194318chr13102570 2517 2424 2402 2030 1685 1577 768 536 518 ----11985
NM_197941chr5133096 3065 2888 2767 2757 2559 1222 681 668 608 558 530 332 ----12734
NM_198150chr551508 1133 613 588 401 161 --3468 409 92
NM_198273chr582510 2154 2138 1117 602 548 354 73 --52242 1015 822 659 312 22756 732
NM_198503chr1112440 2422 2334 2210 1592 1489 949 850 518 274 98 12094 21532 854 22298 2143
NM_198581chr2257572 7518 6873 6754 6646 6428 6337 6243 6021 5875 3025 2804 2377 2266 1934 1794 1669 1446 1321 1194 1164 902 806 785 83 27243 1883 55855 4753 4685 328 205 --
NM_198715chr1156217 5707 5462 4904 4787 4469 4332 4156 4114 3888 3872 2018 1852 1149 283 41723 1473 592 312 34473 2290 1993 --
NM_198859chr354794 4424 3138 1596 789 13731 53764 2042 1840 765 365 --
NM_198935chr2062752 2444 2302 2225 1237 895 --22413 1090 12470
NM_199072chr783257 3200 3159 2649 2468 2154 399 131 22714 2586 22631 807 --
NM_203390chr8101853 1719 1694 1650 1634 1614 1233 746 399 142 --1509 11413
NM_203406chr5122909 2873 2839 2685 2587 2571 2413 2024 1996 1900 1145 73 1551 52721 2656 2000 1149 797 --
NM_203458chr1153622 3558 3404 2811 2797 2515 2396 1490 1211 1003 914 814 784 641 497 --43478 1298 1228 112 --
NM_203463chr294157 3970 3802 3104 1848 1730 1704 209 136 2910 805 54930 3613 3519 1788 1734 11635
NM_206853chr6163994 3726 3680 3639 3309 3195 3063 3039 2754 1620 1559 1058 913 736 191 184 --24140 382 13525
NM_206854chr6145255 4987 4941 4900 4570 4456 4324 4300 4015 3652 1997 1452 1445 929 1724 45401 3477 1643 405 24786 3616
NM_206933chr1102663 2429 1906 793 467 311 264 177 130 115 --22816 379 1457
NM_207303chr10113565 3469 3410 2890 2788 1622 1291 875 835 366 302 11496 12871 --
NM_207322chr1572114 2007 1368 867 567 272 127 --11372 1572
NM_207406chr495898 4923 4727 4576 4223 3984 1739 1602 520 15169 46240 5070 4355 957 1242
NM_207647chr9102239 2132 1957 1824 1723 1648 986 849 578 218 --1809 1854
NM_213589chr274705 4383 3831 2230 2049 820 810 2799 703 33634 3386 1689 11603
NM_213606chr1072690 2666 2561 2521 2254 658 304 2296 286 --12183