TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-99b-3p
miRNA Sequence: CAAGCUCGUGUCUGUGGGUCCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5----11235 --
NM_000037chr842336 1963 461 353 ------
NM_000038chr511934 ------
NM_000052chrX22176 631 ------
NM_000068chr1921541 1153 ------
NM_000084chrX86473 5608 5554 5155 1992 876 717 443 15338 ----
NM_000092chr263932 3701 3612 1688 1657 396 13461 ----
NM_000093chr922522 575 ------
NM_000096chr31951 ------
NM_000104chr221031 195 12400 ----
NM_000109chrX22362 665 1162 ----
NM_000112chr533859 922 172 14284 ----
NM_000138chr1531926 1802 1778 ------
NM_000139chr111761 ------
NM_000142chr431361 1305 116 ------
NM_000165chr61292 11344 ----
NM_000176chr533376 3050 2448 11301 ----
NM_000183chr21168 ------
NM_000194chrX2102 22 ------
NM_000212chr1742475 888 509 248 ------
NM_000222chr441844 1543 620 586 1485 ----
NM_000232chr433222 3187 80 ------
NM_000252chrX31177 566 463 1320 ----
NM_000259chr1544988 4586 376 340 1243 ----
NM_000267chr1712320 ------
NM_000271chr182526 439 ------
NM_000272chr211270 ------
NM_000280chr113904 403 78 ------
NM_000286chr172829 645 ------
NM_000302chr11707 ------
NM_000310chr121178 89 ------
NM_000314chr1052979 2565 2252 851 382 12784 ----
NM_000332chr696858 5476 5217 4552 2514 1792 1748 972 271 11547 14544 --
NM_000346chr1721669 1220 ------
NM_000347chr14129 ------
NM_000362chr2242380 879 718 46 ------
NM_000368chr974801 4236 4217 3119 3032 2968 1008 ------
NM_000388chr31795 ------
NM_000393chr212006 1496 ----
NM_000408chr213136 ------
NM_000430chr1743533 2978 415 76 1133 ----
NM_000439chr521623 164 12521 ----
NM_000445chr81888 ------
NM_000448chr1193226 2367 855 840 509 173 99 65 41 1679 ----
NM_000452chr1332001 1437 27 ------
NM_000459chr9--1870 ----
NM_000461chr334241 3141 921 ------
NM_000462chr1521421 584 ------
NM_000489chrX23025 1155 ------
NM_000493chr61130 ------
NM_000503chr811465 ------
NM_000523chr221125 754 ------
NM_000555chrX57681 6216 6201 2569 1638 1679 ----
NM_000572chr13837 392 174 ------
NM_000587chr511130 11240 ----
NM_000616chr1211446 --11102 --
NM_000617chr1232270 2078 760 ------
NM_000618chr1245782 1983 446 63 ------
NM_000618chr1245782 1983 446 63 ------
NM_000633chr1812007 11376 ----
NM_000665chr71166 ------
NM_000684chr1011080 ------
NM_000701chr1188 ------
NM_000718chr9160 ------
NM_000719chr1266616 5440 4747 954 686 607 --123 --
NM_000726chr211323 ------
NM_000793chr1454165 3827 1287 1155 744 44458 4038 115 23 ----
NM_000794chr52365 64 ------
NM_000806chr521517 722 11646 ----
NM_000807chr4--1682 ----
NM_000826chr421960 350 1916 ----
NM_000828chrX32001 836 753 ------
NM_000829chr1121580 172 ------
NM_000831chr195706 1976 1781 1691 1671 1350 629 186 92 ------
NM_000840chr71407 ------
NM_000875chr1556754 6658 5261 2446 73 ------
NM_000876chr61127 ------
NM_000883chr71446 ------
NM_000883chr71446 ------
NM_000899chr1254196 4023 3741 2965 2809 ------
NM_000917chr10--2248 84 ----
NM_000919chr51177 ------
NM_000922chr111309 ------
NM_000944chr4149 ------
NM_000950chrX23062 2998 1947 ----
NM_000963chr11245 ------
NM_000964chr1741372 1169 1039 939 ------
NM_000966chr1231074 123 39 ------
NM_000983chr151330 1132 1089 368 126 11414 11603 --
NM_001001323chr1222533 586 174 ----
NM_001001331chr332286 1014 473 2544 232 ----
NM_001001395chr1222632 451 12733 ----
NM_001001396chr194412 4085 3945 3552 3535 3286 3271 1252 1186 11483 ----
NM_001001419chr534115 3993 1370 2496 83 ----
NM_001001420chr534115 3993 1370 2496 83 ----
NM_001001484chr1011551 ------
NM_001001485chr3150 ------
NM_001001521chr21131 ------
NM_001001549chr71484 12467 ----
NM_001001550chr71484 12467 ----
NM_001001555chr71484 12467 ----
NM_001001557chr842081 1982 1389 629 1686 ----
NM_001001664chr233667 2987 2626 23856 3283 ----
NM_001001665chr252788 2382 2232 800 775 --12716 --
NM_001001890chr2143984 3678 1514 583 ------
NM_001001933chr1--1606 ----
NM_001002265chr101282 ------
NM_001002266chr101282 ------
NM_001002295chr1011011 ------
NM_001002814chr833774 2484 1275 11508 ----
NM_001002838chrX21819 1435 1114 ----
NM_001002843chr15167 ------
NM_001002860chr1451789 1574 1521 1268 611 13444 ----
NM_001002901chr1--1451 ----
NM_001002909chr171130 ------
NM_001003406chr2293007 2770 2455 2187 2060 1045 776 365 140 1311 ----
NM_001003652chr18128436 8373 7428 7118 6544 6380 5898 3419 3282 3132 1971 1356 1633 ----
NM_001003679chr122174 889 ------
NM_001003688chr4--1970 ----
NM_001003698chr631541 412 370 ------
NM_001003699chr631541 412 370 ------
NM_001003712chr121202 23791 3450 ----
NM_001003792chr31968 11057 ----
NM_001003793chr31968 11057 ----
NM_001004065chr944008 3768 3046 1456 ------
NM_001004127chr1331015 907 892 ------
NM_001004342chr146068 5243 5229 1037 --1299 --
NM_001004346chr42451 185 ------
NM_001004356chr411489 ------
NM_001004358chr411489 ------
NM_001004360chr221923 407 ------
NM_001004441chr52639 485 ------
NM_001004722chr22398 90 ------
NM_001005158chr3121 ------
NM_001005159chr3121 ------
NM_001005266chr151652 ------
NM_001005267chr151652 ------
NM_001005268chr151652 ------
NM_001005269chr151652 ------
NM_001005336chr91210 ------
NM_001005366chr122680 147 1140 ----
NM_001005386chr221799 386 2884 189 ----
NM_001005473chr555145 4957 4673 4040 1351 ------
NM_001005502chr1242061 1047 915 619 ------
NM_001005732chr212555 260 ------
NM_001005733chr211512 ------
NM_001005743chr1421127 542 ------
NM_001005744chr1421127 542 ------
NM_001005745chr1421127 542 ------
NM_001005746chr211323 ------
NM_001005747chr211323 ------
NM_001005910chr31592 ------
NM_001005911chr31592 ------
NM_001006600chr51701 ------
NM_001006610chr161284 1794 ----
NM_001007023chr1454165 3827 1287 1155 744 44458 4038 115 23 ----
NM_001007024chr1744065 3682 289 161 ------
NM_001007025chr1744065 3682 289 161 ------
NM_001007072chr15199 ------
NM_001007099chr12572 263 ------
NM_001007100chr12572 263 ------
NM_001007102chr63286 232 179 ------
NM_001007156chr1531466 1362 734 ------
NM_001007226chr1751375 1270 389 241 96 ------
NM_001007227chr1751375 1270 389 241 96 ------
NM_001007228chr1751375 1270 389 241 96 ------
NM_001007229chr1751375 1270 389 241 96 ------
NM_001007230chr1751375 1270 389 241 96 ------
NM_001007237chr162556 2433 2122 1036 923 325 ------
NM_001007246chr2131925 1799 679 ------
NM_001007277chr1111110 ------
NM_001007466chr635009 3987 3211 24765 2013 ----
NM_001007553chr12256 120 ------
NM_001008239chr1821136 576 ------
NM_001008391chr111290 ------
NM_001008541chr102479 394 ------
NM_001008541chr102479 394 ------
NM_001008564chr131585 12199 ----
NM_001008660chr11--21256 1131 ----
NM_001008738chr562695 2497 2450 2370 1827 303 ------
NM_001008938chr111383 ------
NM_001009899chr355903 5478 5188 2540 812 2856 491 ----
NM_001009958chr71635 ------
NM_001009993chr214498 21424 669 ----
NM_001010853chr622649 979 22495 939 ----
NM_001010854chr142276 63 1658 ----
NM_001010861chr122194 169 ------
NM_001010862chrX--22161 695 ----
NM_001010867chr1116648 5866 5021 4763 4721 2578 2386 1699 1273 1089 829 24892 919 1439 --
NM_001010877chr6--1176 ----
NM_001010888chrX74329 4054 3884 2898 1369 718 376 ------
NM_001010908chr10133 ------
NM_001010923chr641639 1196 617 525 ------
NM_001010924chr1011120 ------
NM_001010934chr72282 200 ------
NM_001010942chr1221264 222 ------
NM_001010986chrX12158 ------
NM_001010989chr162223 99 ------
NM_001010990chr162223 99 ------
NM_001011513chr473842 2939 2506 1362 1271 600 95 ------
NM_001011666chr755719 5412 1422 946 445 15938 ----
NM_001011885chr1511811 11347 ----
NM_001012393chr1134527 4181 88 13784 ----
NM_001012419chr931241 1097 1007 ------
NM_001012420chr1551122 780 621 451 267 1821 ----
NM_001012423chr1551122 780 621 451 267 21027 821 ----
NM_001012456chr7121 ------
NM_001012643chr191480 ------
NM_001012979chrX1241 ------
NM_001013031chr1042821 572 445 432 12831 ----
NM_001013620chr1237787 6395 2367 11609 ----
NM_001013622chr48798 446 385 323 261 199 138 76 --11208 --
NM_001013703chr153440 331 183 ------
NM_001013839chr1742596 2522 1833 89 11891 ----
NM_001013843chr151728 ------
NM_001014286chr13165 ------
NM_001014434chr11268 1174 ----
NM_001014831chr191794 ------
NM_001014832chr191794 ------
NM_001014834chr191794 ------
NM_001014835chr191794 ------
NM_001015048chr1452598 2571 2121 1167 66 22984 744 ----
NM_001015049chr1452598 2571 2121 1167 66 22984 744 ----
NM_001015877chrX42604 1035 617 183 ------
NM_001017369chr431097 993 866 ------
NM_001017424chr121369 98 ------
NM_001017425chr121369 98 ------
NM_001017440chr777900 6871 2751 2716 2338 1076 486 11233 ----
NM_001017524chr1121133 164 ------
NM_001017926chr821602 332 1553 ----
NM_001017930chrX21329 1217 ----11445
NM_001017961chr1187 ------
NM_001017962chr10--2248 84 ----
NM_001017963chr142349 207 ------
NM_001017977chr13283 112 78 ------
NM_001017995chr574566 4201 3345 3004 1872 743 156 11306 ----
NM_001018004chr152679 453 1237 ----
NM_001018005chr15263 41 ------
NM_001018006chr152679 453 1237 ----
NM_001018007chr152679 453 1237 ----
NM_001018020chr152679 453 1237 ----
NM_001018064chr92518 49 11318 ----
NM_001018065chr975965 5931 5348 5220 3912 1792 476 14634 ----
NM_001018066chr975965 5931 5348 5220 3912 1792 476 14634 ----
NM_001018074chr533376 3050 2448 11301 ----
NM_001018075chr533376 3050 2448 11301 ----
NM_001018076chr533376 3050 2448 11301 ----
NM_001018077chr533376 3050 2448 11301 ----
NM_001018111chr753670 2889 1172 920 217 1738 ----
NM_001020825chr51525 ------
NM_001024024chr14188 ------
NM_001024070chr14184 ------
NM_001024094chr533376 3050 2448 11301 ----
NM_001024401chr1682567 2281 2108 1017 1000 336 209 159 1523 ----
NM_001024455chrX72527 2518 2430 2424 2394 263 107 1700 ----
NM_001024660chr331391 507 193 ------
NM_001024809chr1741372 1169 1039 939 ------
NM_001024847chr322124 1765 ------
NM_001024855chr31408 1141 ----
NM_001024947chr51810 ------
NM_001024948chr132231 599 128 ------
NM_001025068chr31324 11449 ----
NM_001025069chr31324 11449 ----
NM_001025076chr1021496 1118 ------
NM_001025077chr1032854 2476 1005 ------
NM_001025079chr354171 3737 2815 2806 2689 ------
NM_001025205chr31416 ------
NM_001025252chr823151 2401 ------
NM_001025253chr823151 2401 ------
NM_001025266chr344722 1604 872 624 --21771 43 --
NM_001025366chr61313 ------
NM_001025366chr61313 ------
NM_001025367chr61313 ------
NM_001025367chr61313 ------
NM_001025368chr61313 ------
NM_001025368chr61313 ------
NM_001025369chr61329 ------
NM_001025369chr61329 ------
NM_001025370chr61313 ------
NM_001025370chr61313 ------
NM_001025580chrX31225 676 496 ------
NM_001029858chr612390 ------
NM_001029875chr532697 2342 575 ------
NM_001029891chrX--1266 ----
NM_001030007chr1643704 3201 1350 696 ----1659
NM_001030055chr1444045 3464 1819 1439 ------
NM_001030272chr11158 ------
NM_001030273chr11158 ------
NM_001031623chr621400 65 ------
NM_001031679chr1252581 2301 1078 890 502 12778 ----
NM_001031690chr73269 232 122 12818 ----
NM_001031695chr2275176 5123 4876 4520 1689 1281 494 --12141 --
NM_001031748chr121232 ------
NM_001031804chr1683604 3007 1640 821 713 662 535 69 21114 851 2219 125 --
NM_001031812chr5--11812 ----
NM_001032280chr6--11468 ----
NM_001032296chr1332618 2514 1906 ------
NM_001032380chr1031800 1280 1242 1746 ----
NM_001032393chrX1187 ------
NM_001033117chr363879 3516 3425 1587 1504 552 --13630 --
NM_001033561chr171246 ------
NM_001033723chr842376 2110 1844 78 ------
NM_001033756chr63713 704 247 ------
NM_001033756chr63713 704 247 ------
NM_001033925chr1021996 1404 ------
NM_001034845chr43935 440 280 11044 ----
NM_001034954chr1031983 1202 480 ------
NM_001034955chr1031983 1202 480 ------
NM_001034956chr1031983 1202 480 ------
NM_001034957chr1031983 1202 480 ------
NM_001035chr12487 317 1955 ----
NM_001035003chr41162 ------
NM_001035004chr41162 ------
NM_001035260chr1011533 ------
NM_001037131chr21483 ------
NM_001037165chr798776 8329 7863 7645 7523 7505 6050 3035 2741 ------
NM_001037174chr22649 313 ------
NM_001037317chr122194 169 ------
NM_001037324chr3--1713 ----
NM_001037334chr1831992 806 73 ------
NM_001037339chr131296 1180 131 1457 ----
NM_001037340chr131296 1180 131 1457 ----
NM_001037341chr131296 1180 131 1457 ----
NM_001037341chr131296 1180 131 1457 ----
NM_001037533chr1----1575 --
NM_001037808chr161153 ------
NM_001038640chr152850 691 --1334 --
NM_001039459chr71987 ------
NM_001039479chr1451504 816 745 224 44 ------
NM_001039538chr263356 2879 2867 1084 614 45 12779 ----
NM_001039547chr347601 7591 7324 5403 2899 543 ----
NM_001039550chr25902 893 851 646 603 ------
NM_001039580chr414192 ------
NM_001039585chr1--32903 517 183 ----
NM_001039590chrX43460 3054 2627 748 21003 127 ----
NM_001039591chrX43460 3054 2627 748 21003 127 ----
NM_001039618chr1185765 5589 5107 4700 3896 3663 1463 658 ------
NM_001039693chr213022 14014 ----
NM_001039762chr10--152 ----
NM_001039802chr11869 ------
NM_001039937chr1323637 1108 ------
NM_001040059chr172593 208 ------
NM_001040100chr331266 1162 152 ------
NM_001040142chr211531 1615 ----
NM_001040143chr211531 1615 ----
NM_001040152chr71818 1529 14004 --
NM_001040159chr41190 ------
NM_001040214chr622257 375 198 ----
NM_001040284chr1674923 4683 4202 1927 1630 1446 1036 14422 ----
NM_001040402chr411096 ------
NM_001040429chr1333223 1312 1184 11134 ----
NM_001040446chr562662 2574 1713 1703 941 314 ------
NM_001040450chr1532872 197 190 1602 ----
NM_001040453chr1532872 197 190 1602 ----
NM_001040619chr131111 1050 375 ------
NM_001040708chr821014 966 ------
NM_001040709chr132452 1795 120 11001 ----
NM_001040712chr911341 ------
NM_001042425chr6--11468 ----
NM_001042427chr101271 ------
NM_001042453chrX187 ------
NM_001042481chr1432535 2080 1711 1754 ----
NM_001042486chr2031266 1179 73 ------
NM_001042492chr1712320 ------
NM_001042494chr151137 12467 ----
NM_001042495chr151137 12467 ----
NM_001042496chr151137 12467 ----
NM_001042497chr151137 12467 ----
NM_001042533chr333230 2103 342 ----1645
NM_001042539chr162180 148 ------
NM_001042555chr1224689 919 ------
NM_001042601chr31273 ------
NM_001042604chr333749 3521 886 24842 1408 ----
NM_001042610chr1641411 1193 1165 1015 11047 ----
NM_001042681chr112469 ------
NM_001042682chr112469 ------
NM_001042682chr112469 ------
NM_001042683chr631737 1455 1173 ------
NM_001042728chr1231074 123 39 ------
NM_001043318chr1453174 1244 1028 174 38 --1965 --
NM_001043351chr122167 1586 11972 ----
NM_001044385chr233986 3197 741 ------
NM_001044722chr5--11812 ----
NM_001044723chr5--11812 ----
NM_001046chr512740 12718 ----
NM_001048183chr133479 2316 245 ------
NM_001077628chr13518 170 162 ------
NM_001079874chr11618 ------
NM_001083620chr421958 349 1915 ----
NM_001100108chr197161 7053 6272 6127 5627 5096 1976 1945 1665 --16626 --
NM_001106chr3118986 8745 8292 8182 7497 6730 6052 2946 1856 475 263 38959 2182 543 18719 --
NM_001113490chrX53608 3414 2971 2902 534 ------
NM_001116chr1612944 22260 433 12457 --
NM_001117chr1822185 328 ------
NM_001121chr1011175 ------
NM_001122679chr5----11235 --
NM_001128chr1643704 3201 1350 696 ----1659
NM_001135chr15--1248 ----
NM_001167chrX65402 4577 4445 2177 1387 364 16399 ----
NM_001173chr1444045 3464 1819 1439 ------
NM_001178chr11158 ------
NM_001204chr227634 4691 ------
NM_001206chr932154 2096 1096 ------
NM_001222chr102439 382 ------
NM_001241chr212032 11695 ----
NM_001241chr212032 11695 ----
NM_001251chr172593 208 ------
NM_001256chr1751871 1180 754 359 90 ------
NM_001261chr92798 342 184 ----
NM_001265chr135967 860 803 699 257 ------
NM_001268chr13195 1172 ----
NM_001269chr11973 ------
NM_001271chr1562220 2003 1314 710 496 99 ------
NM_001280chr192273 61 ------
NM_001304chr1762902 2458 563 489 261 108 22889 273 ----
NM_001310chr1232093 975 441 ------
NM_001326chr111305 ------
NM_001329chr1021618 284 ------
NM_001330chr161955 ------
NM_001331chr1152273 2109 2042 1933 495 22382 29 ----
NM_001332chr51251 ------
NM_001346chr342039 2010 1938 1881 ------
NM_001351chr321509 421 11333 ----
NM_001356chrX31952 788 515 ------
NM_001358chr4170 ------
NM_001364chr1154494 4384 1782 1420 1240 24547 1808 1264 --
NM_001387chr522256 1069 13150 12639 --
NM_001389chr211192 ------
NM_001392chr18152 ------
NM_001407chr321175 574 ------
NM_001412chrX11239 1224 ----
NM_001419chr1954618 3095 686 605 532 --1770 --
NM_001423chr1251986 1350 763 587 502 ------
NM_001427chr721706 205 1532 ----
NM_001430chr21708 11981 ----
NM_001431chr61493 ------
NM_001438chr143465 2787 1201 180 185 12956 --
NM_001463chr21226 1629 ----
NM_001490chr922816 580 2980 570 ----
NM_001498chr611022 1169 ----
NM_001514chr11527 ------
NM_001530chr14--1300 ----
NM_001542chr162556 2433 2122 1036 923 325 ------
NM_001543chr543595 3152 1297 841 1975 14431 --
NM_001546chr6--11063 ----
NM_001584chr1121124 899 1794 ----
NM_001604chr113904 403 78 ------
NM_001610chr112728 710 ------
NM_001616chr232446 1008 964 ------
NM_001626chr1993087 3071 2719 2552 1281 1196 762 642 332 11335 ----
NM_001642chr111473 ------
NM_001650chr1823117 2544 23572 412 ----
NM_001655chr1131957 580 73 ------
NM_001660chr31766 ------
NM_001668chr141732 1652 1517 452 ------
NM_001682chr1222247 300 ------
NM_001683chr332286 1014 473 2544 232 ----
NM_001684chr194129 3802 3662 3269 3252 3003 2988 969 903 11200 ----
NM_001690chr312312 ------
NM_001693chr811024 197 ----
NM_001695chr854268 4001 3102 3083 984 22939 240 ----
NM_001704chr61441 ------
NM_001714chr121529 ------
NM_001717chr151475 ------
NM_001718chr61219 11193 ----
NM_001735chr91395 ------
NM_001737chr5121 ------
NM_001740chr16--1530 ----
NM_001753chr721226 172 ------
NM_001754chr2143984 3678 1514 583 ------
NM_001755chr1621961 892 ------
NM_001759chr1243736 3541 3353 368 ------
NM_001773chr121258 955 ------
NM_001777chr354171 3737 2815 2806 2689 ------
NM_001791chr11869 ------
NM_001792chr182865 194 ------
NM_001797chr161777 ------
NM_001799chr5199 ------
NM_001802chr162805 340 ------
NM_001830chrX2236 212 ------
NM_001854chr1----11487 --
NM_001856chr11327 ------
NM_001858chr645147 1922 681 248 11488 ----
NM_001874chr1242061 1047 915 619 ------
NM_001894chr2221232 139 --1444 --
NM_001904chr31425 ------
NM_001938chr11688 ------
NM_001939chrX53130 3062 1326 1270 788 ------
NM_001942chr1812072 ------
NM_001949chr682596 2198 2014 1142 1048 1025 988 755 ------
NM_001964chr52907 354 ------
NM_001965chr2151 ------
NM_001967chr31161 ------
NM_001968chr41203 ------
NM_001977chr4--2529 22 ----
NM_001981chr132307 2185 260 ------
NM_001999chr531451 487 311 ------
NM_002006chr434649 4302 1430 1489 ----
NM_002015chr1311305 ----13155
NM_002017chr111912 ------
NM_002024chrX11397 ------
NM_002025chrX119239 8605 8531 7022 3469 3313 3010 2921 2436 1905 1754 11778 ----
NM_002039chr41870 ------
NM_002048chr921369 205 ------
NM_002051chr1011011 ------
NM_002061chr131915 1851 1300 ------
NM_002076chr1263123 2642 2502 1123 967 106 ------
NM_002077chr912058 ------
NM_002080chr16162 1259 ----
NM_002086chr171215 ------
NM_002114chr62383 206 ------
NM_002166chr21506 ------
NM_002181chr22210 91 --1299 --
NM_002184chr51152 ------
NM_002203chr524170 1667 2668 274 ----
NM_002207chr31236 ------
NM_002211chr101349 ------
NM_002214chr743749 1561 1186 862 35654 4323 361 ----
NM_002229chr19--1418 ----
NM_002230chr174977 377 253 133 ------
NM_002247chr101290 ------
NM_002252chr21322 ------
NM_002264chr334206 3715 1701 ------
NM_002265chr171200 11106 ----
NM_002267chr1331653 1547 806 12436 ----
NM_002270chr565573 5149 4443 4405 3982 2044 ------
NM_002293chr112143 22111 152 ----
NM_002314chr73975 931 277 ------
NM_002351chrX3700 182 88 11592 ----
NM_002354chr22382 100 ------
NM_002359chr1783782 3723 2986 2739 2712 1451 415 160 1974 1506 --
NM_002374chr263356 2879 2867 1084 614 45 12779 ----
NM_002390chr1742074 1592 1427 649 ------
NM_002397chr51725 ------
NM_002406chr54320 293 262 45 ------
NM_002408chr141841 179 ----
NM_002430chr2241705 1614 1600 124 ------
NM_002442chr1221543 1321 ------
NM_002473chr221347 ------
NM_002480chr12----1444 --
NM_002499chr1532295 1886 958 --11697 --
NM_002501chr1911193 22914 2693 ----
NM_002508chr131696 1323 376 11990 ----
NM_002515chr1411326 ------
NM_002522chr1743275 2828 1494 1152 23950 2902 ----
NM_002543chr12141 ------
NM_002544chr172229 88 ------
NM_002545chr1134527 4181 88 13784 ----
NM_002570chr1511222 ------
NM_002577chr342715 1133 863 374 ------
NM_002600chr131296 1180 131 1457 ----
NM_002608chr2241576 1478 1379 332 ------
NM_002609chr541859 745 591 502 --181 --
NM_002628chr31894 ------
NM_002635chr121144 ------
NM_002655chr864716 3591 1972 1888 1389 165 ------
NM_002657chr2062896 1536 1195 1065 766 90 ------
NM_002667chr63846 200 114 1308 ----
NM_002687chr141826 11161 ----
NM_002707chr2164 ------
NM_002709chr243330 3064 478 385 ------
NM_002715chr51455 21046 404 ----
NM_002716chr1133190 3052 2940 23644 1054 ----
NM_002731chr1125 ------
NM_002737chr1745526 5476 4702 1605 --15671 --
NM_002745chr2254077 4065 942 876 519 ------
NM_002753chr41818 ------
NM_002775chr101520 ------
NM_002821chr65607 597 517 223 217 ------
NM_002827chr2051752 1603 1597 1446 501 ------
NM_002835chr7--1288 ----
NM_002839chr911341 ------
NM_002843chr1143161 2718 2692 2442 ------
NM_002844chr611055 ------
NM_002849chr123807 357 79 ------
NM_002858chr121189 276 190 ----
NM_002868chr1252282 2271 1767 561 218 ------
NM_002874chr922089 1795 ------
NM_002883chr224965 813 277 41 ------
NM_002890chr51126 ------
NM_002893chrX1149 ------
NM_002894chr181204 ------
NM_002900chr101119 ------
NM_002906chr11--1787 ----
NM_002942chr321056 513 ------
NM_002955chr631541 412 370 ------
NM_002956chr123503 205 27 ------
NM_002959chr152994 2883 2821 1689 276 --14281 --
NM_002970chrX1315 ------
NM_002971chr31449 11096 ----
NM_002976chr21362 1209 ----
NM_002977chr253397 3067 3004 1328 500 12412 ----
NM_002979chr12572 263 ------
NM_002985chr173707 663 566 1833 ----
NM_003009chr191284 ------
NM_003010chr1732339 2214 439 12131 1424 --
NM_003016chr171724 ------
NM_003028chr942819 1531 780 242 ------
NM_003031chr161284 1794 ----
NM_003034chr12107875 6378 6287 2240 2094 1417 1292 1041 312 93 ------
NM_003035chr12938 329 ------
NM_003043chr374294 3209 3077 3002 1454 258 81 ------
NM_003045chr1331727 616 301 14600 13278 --
NM_003060chr51456 ------
NM_003071chr33593 471 70 ------
NM_003074chr352239 1439 817 542 42 21801 1785 ----
NM_003076chr1241686 1204 647 387 ------
NM_003081chr201250 ------
NM_003093chr6184 ------
NM_003098chr20154 ------
NM_003107chr631638 652 417 192 2381 336 --
NM_003108chr277280 6899 6110 5637 1989 1899 710 25790 778 ----
NM_003131chr662260 1843 1762 1531 884 500 11786 ----
NM_003137chr642016 902 472 106 22114 843 ----
NM_003144chr631770 1598 1547 ------
NM_003155chr82675 513 ------
NM_003161chr1712587 ------
NM_003174chr101115 ------
NM_003178chr321853 1576 1628 ----
NM_003199chr1811007 ------
NM_003215chr411034 ------
NM_003216chr2252645 2567 2479 1126 596 ------
NM_003217chr1261779 1379 1365 554 438 186 ------
NM_003220chr6--11468 ----
NM_003221chr633039 1045 1023 ----23604 269
NM_003242chr322124 1765 ------
NM_003246chr15171 11574 ----
NM_003285chr11449 ------
NM_003291chr131266 ------
NM_003302chr7------1144
NM_003320chr1144237 1191 488 46 13802 ----
NM_003337chr531561 1233 266 ------
NM_003340chr4--11145 ----
NM_003342chr1723304 755 12886 ----
NM_003344chr721473 1430 ------
NM_003348chr1211593 ------
NM_003360chr41217 ------
NM_003373chr102537 467 ------
NM_003376chr61313 ------
NM_003376chr61313 ------
NM_003379chr62948 399 ------
NM_003392chr323551 1592 ------
NM_003410chrX1550 ------
NM_003411chrY1503 ------
NM_003413chrX186 ------
NM_003418chr31113 ------
NM_003430chr1921375 101 ------
NM_003432chr51213 ------
NM_003453chr131106 ------
NM_003458chr343390 2942 489 427 ------
NM_003463chr632969 2178 1064 ------
NM_003468chr264119 3390 812 584 537 315 ------
NM_003469chr21166 ------
NM_003472chr631159 293 164 ------
NM_003478chr1133118 687 485 12631 ----
NM_003480chr1211979 ------
NM_003483chr1212052 ------
NM_003487chr17159 ------
NM_003506chr811109 ------
NM_003508chr7--1271 ----
NM_003563chr1751375 1270 389 241 96 ------
NM_003564chr12656 641 ------
NM_003566chr1232947 2854 945 1188 ----
NM_003567chr1--1350 ----
NM_003574chr1845358 4671 4635 541 14300 ----
NM_003576chr1332618 2514 1906 ------
NM_003583chr1253561 2628 2386 1318 698 ------
NM_003603chr44833 747 641 601 ------
NM_003607chr163816 2736 1262 1186 845 391 1533 ----
NM_003615chr343126 1295 472 137 12518 ----
NM_003633chr542392 1839 423 34 ------
NM_003644chr1766609 6049 5712 5061 5053 382 16556 1302 --
NM_003653chr17121 ------
NM_003663chr321258 843 1941 ----
NM_003666chr12638 485 ------
NM_003671chr942889 2720 173 153 ------
NM_003713chr121171 21 ------
NM_003741chr33377 352 45 ------
NM_003743chr22421 157 ------
NM_003744chr1421127 542 ------
NM_003750chr101695 ------
NM_003752chr161153 ------
NM_003769chr12146 ------
NM_003774chr1262921 968 674 591 232 27 21179 526 ----
NM_003778chr33696 596 115 ------
NM_003787chr1831652 1365 198 ------
NM_003800chr621576 1506 ------
NM_003811chr193264 200 107 ------
NM_003816chr82334 44 ------
NM_003825chr1531288 610 538 21157 76 ----
NM_003840chr881852 1524 1488 698 692 345 336 27 1722 ----
NM_003861chr141918 12272 ----
NM_003864chr41163 ------
NM_003870chr1512058 11764 ----
NM_003872chr252964 1036 845 831 302 12158 ----
NM_003873chr102135 58 ------
NM_003884chr3--1405 ----
NM_003885chr1751024 777 694 611 457 ------
NM_003895chr2131624 427 201 ------
NM_003901chr1031732 1095 375 --12639 --
NM_003906chr21141 ------
NM_003919chr7190 ------
NM_003932chr2211767 ------
NM_003936chr211075 ------
NM_003941chr742036 1802 1745 790 1277 ----
NM_003947chr32932 235 11076 ----
NM_003953chr11868 1398 ----
NM_003958chr663788 3492 2621 2425 654 493 ------
NM_003971chr171414 ------
NM_003994chr1254196 4023 3741 2965 2809 ------
NM_004006chrX22362 665 1162 ----
NM_004007chrX22362 665 1162 ----
NM_004009chrX22362 665 1162 ----
NM_004010chrX22362 665 1162 ----
NM_004011chrX22362 665 1162 ----
NM_004012chrX22362 665 1162 ----
NM_004013chrX22362 665 1162 ----
NM_004014chrX22362 665 1162 ----
NM_004015chrX22362 665 1162 ----
NM_004016chrX22276 579 176 ----
NM_004017chrX22362 665 1162 ----
NM_004018chrX22276 579 176 ----
NM_004020chrX22362 665 1162 ----
NM_004021chrX22276 579 176 ----
NM_004022chrX22276 579 176 ----
NM_004023chrX22276 579 176 ----
NM_004024chr131020 959 284 ------
NM_004028chr1823117 2544 23572 412 ----
NM_004035chr1773948 3840 3700 3489 1782 1071 520 --15005 --
NM_004036chr22669 152 ------
NM_004052chr10148 ------
NM_004068chr31416 ------
NM_004093chr1332401 1081 454 1485 ----
NM_004098chr1021133 1004 ------
NM_004107chr19----1205 --
NM_004114chrX1193 ------
NM_004117chr631658 741 55 ------
NM_004124chr1433086 2498 680 22968 2819 ----
NM_004133chr841816 415 288 211 ------
NM_004169chr17183 ------
NM_004183chr11--1320 ----
NM_004202chrY1108 ------
NM_004226chr2--1249 ----
NM_004227chr742544 2224 2141 776 12693 ----
NM_004229chrX11402 ------
NM_004232chr1822703 495 ------
NM_004255chr151168 ------
NM_004272chr511662 11951 ----
NM_004277chr61548 ------
NM_004293chr943836 3587 3045 369 11424 ----
NM_004302chr121660 ------
NM_004311chr1042926 2607 2203 330 ------
NM_004317chr19173 ------
NM_004330chr151812 ------
NM_004331chr81260 1233 ----
NM_004359chr19------128
NM_004364chr191248 ------
NM_004379chr22397 354 ------
NM_004384chr5--11812 ----
NM_004386chr1912237 ------
NM_004392chr13--1867 ----
NM_004397chr1123179 926 34269 1537 437 ----
NM_004408chr91134 ------
NM_004412chr1065675 4423 3744 1973 1891 307 ------
NM_004414chr213358 345 227 ------
NM_004417chr51125 ------
NM_004418chr21123 ------
NM_004427chr141054 972 775 221 11146 ----
NM_004428chr12741 327 ------
NM_004430chr842229 929 590 454 11804 ----
NM_004432chr921904 762 --11998 --
NM_004433chr131779 1378 675 ------
NM_004437chr163468 3002 1324 662 259 198 21224 153 ----
NM_004438chr263302 2619 1273 477 330 299 1175 ----
NM_004440chr61268 ------
NM_004449chr2131215 1015 334 ------
NM_004454chr322023 1441 ------
NM_004458chrX31785 678 456 ------
NM_004459chr17--21936 616 ----
NM_004481chr162588 2300 2229 2040 814 352 ------
NM_004491chr1954103 3963 2951 1647 207 ------
NM_004500chr1411733 ------
NM_004501chr133673 3421 3412 11330 ----
NM_004505chr17--1323 ----
NM_004514chr1772677 2515 1987 1954 1946 789 242 ------
NM_004529chr911023 ------
NM_004535chr201328 ------
NM_004571chr2152941 2722 2447 1201 35 ------
NM_004577chr71531 ------
NM_004586chrX64942 4770 3324 2164 1557 201 ------
NM_004588chr1164020 3279 3005 1037 926 401 --12730 --
NM_004600chr12549 528 ------
NM_004602chr2021258 177 ------
NM_004630chr1141137 915 868 858 ------
NM_004637chr321148 528 ------
NM_004654chrY1200 ------
NM_004655chr172481 187 ------
NM_004660chrY32089 1881 527 1772 ----
NM_004663chr1531351 973 479 11120 ----
NM_004687chr172723 548 ------
NM_004689chr142424 372 ------
NM_004700chr11136 ------
NM_004703chr1722489 1782 ------
NM_004716chr113815 599 214 ------
NM_004721chr31141 ------
NM_004726chrX105414 4167 3820 3597 3584 3530 1806 1467 857 686 ------
NM_004732chr171260 ------
NM_004742chr321592 419 ------
NM_004744chr433904 2694 2536 12939 ----
NM_004745chr847039 6894 4958 2723 22251 775 1503 14487
NM_004748chr1543781 3657 2679 41 13587 ----
NM_004753chr1138 1262 ----
NM_004766chr31222 1167 ----
NM_004772chr511384 ------
NM_004774chr1732966 2184 1962 22982 710 ----
NM_004779chr53430 420 189 ------
NM_004783chr163145 74 27 ------
NM_004788chr1121751 1015 ------
NM_004794chrX142 ------
NM_004796chr1412308 12038 129 --
NM_004800chr13183 ------
NM_004801chr21489 ------
NM_004815chr124081 3778 11326 ----
NM_004822chr1772778 2547 1142 1133 921 702 100 --11082 --
NM_004824chr631204 162 37 ------
NM_004827chr411565 ------
NM_004834chr273025 2699 2565 2554 2080 1343 612 12654 ----
NM_004836chr21186 ------
NM_004841chr11758 1813 ----
NM_004842chr6--11766 ----
NM_004849chr621710 1176 ------
NM_004850chr211479 1609 ----
NM_004857chr1424667 467 11824 ----
NM_004865chr61333 ------
NM_004867chrX1222 1659 ----
NM_004869chr1821332 489 ------
NM_004871chr1744065 3682 289 161 ------
NM_004873chr1452598 2571 2121 1167 66 22984 744 ----
NM_004879chr111988 ------
NM_004896chr1011448 ------
NM_004902chr201743 ------
NM_004904chr755719 5412 1422 946 445 15938 ----
NM_004923chr111229 1135 ----
NM_004924chr19--11015 ----
NM_004926chr1421684 1487 ------
NM_004929chr811400 11075 ----
NM_004932chr51174 ------
NM_004949chr1831983 1875 145 21902 768 ----
NM_004956chr733916 3433 132 ------
NM_004961chrX21122 110 ------
NM_004973chr621445 511 --11712 --
NM_004976chr1174526 3408 3165 1995 1574 732 546 1654 ----
NM_004979chrX4414 357 232 136 ------
NM_004985chr1251038 1024 461 266 200 ------
NM_004992chrX128541 7827 6664 6428 6073 5716 5392 2394 2173 1940 1768 143 26238 1927 ----
NM_004992chrX128541 7827 6664 6428 6073 5716 5392 2394 2173 1940 1768 143 26238 1927 ----
NM_004993chr1421268 1006 ------
NM_004999chr644185 3210 2787 1186 1399 ----
NM_005023chr511497 ------
NM_005054chr231404 1319 502 11516 ----
NM_005056chr12134038 3754 3725 3696 3667 3638 3609 3580 3475 1540 1513 524 206 ------
NM_005065chr1465102 4860 1275 680 670 196 --1749 --
NM_005070chr21216 ------
NM_005076chr174091 3263 2610 1545 1195 827 258 ------
NM_005079chr823151 2401 ------
NM_005095chr11847 ------
NM_005109chr321825 120 --1360 --
NM_005113chr141187 ------
NM_005116chr2064446 4322 3509 2778 1783 370 --21594 1305 --
NM_005120chrX2223 160 ------
NM_005121chr17--13559 ----
NM_005135chr151137 12467 ----
NM_005137chr2271631 1604 824 656 640 206 129 1355 1194 --
NM_005151chr1831992 806 73 ------
NM_005156chr944821 3311 1124 115 11091 14855 --
NM_005164chr1232638 2305 2180 12645 ----
NM_005168chr22257 207 --11368 --
NM_005171chr1221070 65 ------
NM_005188chr11148307 8181 7816 7274 7258 6468 5891 5698 5382 5272 2395 1969 1583 667 --12703 --
NM_005197chr1485750 5590 4867 4008 3964 1655 1441 1162 ------
NM_005202chr151939 914 729 670 193 ------
NM_005207chr2243398 2345 2263 948 --12591 --
NM_005219chr561650 1433 1175 1131 437 361 11471 ----
NM_005238chr1143522 3468 1318 915 11304 ----
NM_005239chr2121930 811 ------
NM_005245chr41806 ------
NM_005254chr151140 ------
NM_005257chr1811125 ------
NM_005259chr22228 221 ------
NM_005277chr421815 1689 ------
NM_005281chr13349 265 67 ------
NM_005296chrX1144 1439 ----
NM_005311chr71484 12467 ----
NM_005316chr111226 1870 ----
NM_005324chr1731665 780 410 ------
NM_005329chr1621967 437 11511 11788 --
NM_005337chr121311 1414 ----
NM_005339chr433116 316 249 ------
NM_005342chrX32423 1960 380 ------
NM_005348chr142349 207 ------
NM_005349chr41503 ------
NM_005359chr1875376 4569 4198 2617 2007 1764 215 25667 5589 16156 --
NM_005369chrX187 ------
NM_005374chr1722396 870 ------
NM_005376chr1--11137 ----
NM_005392chr921486 85 1426 1556 --
NM_005397chr753670 2889 1172 920 217 1738 ----
NM_005398chr1021453 116 ------
NM_005406chr1821023 325 ------
NM_005430chr12----1719 --
NM_005433chr1822231 701 ------
NM_005436chr1062919 2906 2649 901 401 315 14045 ----
NM_005437chr1021256 54 ------
NM_005479chr1011198 --1977 --
NM_005497chr1785693 5201 4297 2234 1363 1348 1306 469 ------
NM_005504chr1265360 4125 1911 1798 1043 872 16127 ----
NM_005509chr52520 130 11570 ----
NM_005513chr31145 ------
NM_005522chr71505 11089 ----
NM_005537chr131797 ------
NM_005540chr141405 1266 596 291 ------
NM_005542chr721827 109 ------
NM_005544chr22746 306 ------
NM_005570chr1811116 ------
NM_005578chr353738 3589 3164 1916 1252 ------
NM_005596chr916451 12443 ----
NM_005598chr121280 479 ------
NM_005614chr7--1853 ----
NM_005618chr62599 124 ------
NM_005627chr62276 186 ------
NM_005639chr1221364 526 ------
NM_005644chr1152 ------
NM_005650chr2221210 1008 ------
NM_005660chrX1226 ------
NM_005665chr154632 4063 1192 943 62 13603 ----
NM_005668chr523197 2894 14447 ----
NM_005709chr112438 45 ------
NM_005722chr221799 386 2884 189 ----
NM_005725chr11334 11911 ----
NM_005730chr1263421 2800 2754 2591 1108 138 ------
NM_005731chr21160 ------
NM_005734chr111137 ------
NM_005735chr23324 216 194 ------
NM_005756chrX--1375 ----
NM_005809chr19122 ------
NM_005819chr152776 2619 2507 807 24 11174 1448 --
NM_005822chr632162 1620 333 12379 ----
NM_005828chr1764871 4502 3171 755 221 34 11038 ----
NM_005839chr12720 80 ------
NM_005840chrX67481 7447 4735 2781 909 27 ------
NM_005843chr231295 509 380 ------
NM_005853chr161443 ------
NM_005859chr521231 456 ------
NM_005871chr10136 1989 ----
NM_005880chr1621059 472 ------
NM_005883chr1963020 2775 2405 2008 746 533 ------
NM_005884chr191794 ------
NM_005888chr121144 ------
NM_005895chr1253906 3735 3401 422 242 ------
NM_005896chr21593 1127 ----
NM_005898chr1122467 383 ------
NM_005900chr4--1970 ----
NM_005901chr18128436 8373 7428 7118 6544 6380 5898 3419 3282 3132 1971 1356 1633 ----
NM_005903chr534115 3993 1370 2496 83 ----
NM_005904chr18129 11484 ----
NM_005911chr23991 459 178 ------
NM_005920chr173843 2766 2573 2543 673 473 78 ------
NM_005924chr72897 185 ------
NM_005930chr143804 675 250 ------
NM_005933chr112942 132 ------
NM_005934chr19102621 2559 2040 1019 985 856 649 339 230 202 ------
NM_005935chr445081 3628 1030 480 13327 ----
NM_005937chr1762853 2830 2635 1138 1017 544 ------
NM_005938chrX21170 397 ------
NM_005955chr174677 3431 3390 1870 1429 790 394 14158 ----
NM_005962chr102479 394 ------
NM_005962chr102479 394 ------
NM_006007chr924081 107 14286 ----
NM_006015chr12943 322 ------
NM_006016chr632030 1467 1406 ------
NM_006022chr131914 ------
NM_006037chr2104647 4570 4547 4053 1728 1499 817 641 621 334 13979 1669 --
NM_006043chr16----1708 --
NM_006054chr1121624 1417 ----11168
NM_006067chr162778 413 ------
NM_006085chr13243 95 86 ------
NM_006095chr431003 271 117 ----11587
NM_006106chr1152885 2841 2643 2456 2139 1610 ----
NM_006113chr11618 ------
NM_006133chr1141799 564 541 140 11845 ----
NM_006139chr232831 2487 2315 11775 ----
NM_006152chr121207 ------
NM_006160chr1711221 ------
NM_006161chr53638 468 112 1624 ----
NM_006164chr2129 ------
NM_006166chr1252110 859 691 452 244 ------
NM_006178chr171469 11552 ----
NM_006180chr92518 49 11318 ----
NM_006192chr2021062 1042 ------
NM_006195chr9126 ------
NM_006203chr535606 5250 538 34984 3888 592 ----
NM_006210chr191294 ------
NM_006223chrX171 ------
NM_006224chr1732499 2010 481 ------
NM_006243chr1138 ------
NM_006252chr165523 5384 5340 4927 2485 1596 ------
NM_006256chr13530 405 98 1229 ----
NM_006265chr811384 ------
NM_006275chr202388 236 1939 ----
NM_006283chr854090 3648 1791 965 273 ------
NM_006292chr11129 ------
NM_006293chr153394 363 54 ------
NM_006298chr643427 2637 803 21 1293 ----
NM_006306chrX75204 4607 1355 1054 810 465 227 1444 ----
NM_006307chrX1129 ------
NM_006311chr171257 ------
NM_006313chr121105 11687 ----
NM_006317chr51677 ------
NM_006322chr13--1596 ----
NM_006323chr41506 ------
NM_006324chr16149 ------
NM_006325chr122238 150 ------
NM_006345chr421028 931 ------
NM_006352chr131792 811 325 ------
NM_006367chr11295 ------
NM_006371chr355136 3791 3345 1741 996 24683 1143 ----
NM_006374chr2154 ------
NM_006378chr941137 1089 892 59 ------
NM_006379chr73537 359 130 ------
NM_006380chr1723809 3463 1343 ----
NM_006390chr1231578 1461 574 ------
NM_006393chr1054502 3896 3704 3242 24 ------
NM_006420chr2023043 654 1629 ----
NM_006434chr1031983 1202 480 ------
NM_006439chr41541 ------
NM_006457chr473842 2939 2506 1362 1271 600 95 ------
NM_006467chr51509 2731 154 ----
NM_006472chr111229 ------
NM_006482chr1253561 2628 2386 1318 698 ------
NM_006489chr1411326 ------
NM_006509chr191395 ------
NM_006517chrX22335 2185 ------
NM_006534chr2063398 3226 3104 2116 1053 118 ------
NM_006544chr1435211 2395 1009 14393 ----
NM_006546chr1776581 6272 5253 4149 1132 763 112 ------
NM_006547chr732047 1846 1502 ------
NM_006549chr12102673 2232 1982 1971 1844 1165 919 766 618 542 --12773 --
NM_006559chr12833 821 ------
NM_006561chr1021496 1118 ------
NM_006565chr162410 372 ------
NM_006575chr1411139 ------
NM_006577chr2--11177 ----
NM_006595chr1111626 193 ----
NM_006599chr1667903 7714 6394 2291 2102 246 16990 ----
NM_006601chr121802 1952 ----
NM_006614chr31575 ------
NM_006621chr121385 1370 1662 1634 --
NM_006624chr102686 446 22025 341 ----
NM_006646chr1332803 2681 857 ------
NM_006654chr1224689 919 ------
NM_006695chr171255 ------
NM_006698chr2031434 1137 79 ------
NM_006717chr922958 2371 22215 535 ----
NM_006735chr7--181 ----
NM_006736chr251912 1903 1861 1656 1613 ------
NM_006745chr431097 993 866 ------
NM_006750chr16107108 5961 5809 5438 3133 3087 2485 1902 1637 880 ------
NM_006759chr21131 ------
NM_006763chr111978 --11484 --
NM_006775chr632945 642 113 ------
NM_006777chrX42932 2185 1966 1894 ------
NM_006803chr832114 2045 1520 ------
NM_006807chr171999 11074 ----
NM_006811chr201673 ------
NM_006812chr121117 ------
NM_006813chr61885 1121 ----
NM_006815chr12----11171 --
NM_006823chr811329 1390 ----
NM_006825chr121967 ------
NM_006827chr1442675 570 370 111 ------
NM_006838chr1231655 1410 41 ------
NM_006846chr52129 96 ------
NM_006856chr1221134 148 1984 ----
NM_006861chr1221858 709 ----11354
NM_006874chr41951 ------
NM_006885chr1622986 1382 23668 320 ----
NM_006888chr1432877 2771 2503 ------
NM_006892chr2011252 21421 421 ----
NM_006892chr2011252 21421 421 ----
NM_006910chr161157 1265 ----
NM_006922chr211966 ------
NM_006924chr1724462 3363 ------
NM_006948chr212934 605 ------
NM_006981chr922899 24 12272 ----
NM_006999chr561336 837 757 601 266 104 ------
NM_007005chr9--1127 ----
NM_007006chr1642950 1043 672 443 ------
NM_007007chr1213991 ------
NM_007010chr1721476 585 ------
NM_007011chr1556638 6458 4691 1288 1024 ------
NM_007027chr31145 ------
NM_007038chr2125502 920 21663 240 ----
NM_007039chr1431983 880 389 ------
NM_007042chr331975 376 162 11716 ----
NM_007050chr20127536 7377 6326 6310 6301 6020 5624 2279 965 794 590 318 16592 12020 --
NM_007052chrX1165 ------
NM_007064chr331391 507 193 ------
NM_007069chr11167 ------
NM_007078chr1042601 1168 489 466 1347 ----
NM_007106chr1342180 2091 1136 218 ------
NM_007111chr131309 ------
NM_007114chr313025 ------
NM_007125chrY11219 ------
NM_007126chr9127 ------
NM_007137chrX84949 4582 4022 3480 2122 1920 1765 1157 ------
NM_007146chr1722664 2557 1997 ----
NM_007150chrX31985 1675 1360 1325 ----
NM_007157chrX22560 161 12447 ----
NM_007158chr12256 120 ------
NM_007159chr31517 11368 ----
NM_007166chr11--21256 1131 ----
NM_007170chr12805 311 ------
NM_007184chr31577 ------
NM_007189chr721186 1061 1350 ----
NM_007191chr121141 ------
NM_007192chr14123 1987 ----
NM_007198chr821610 192 ------
NM_007203chr944008 3768 3046 1456 ------
NM_007207chr1--1307 ----
NM_007222chr821602 332 1553 ----
NM_007236chr1521665 637 ------
NM_007249chr1369302 9098 6342 2804 2769 307 19322 ----
NM_007282chr31994 ------
NM_007285chr163446 193 181 ------
NM_007292chr1773948 3840 3700 3489 1782 1071 520 --15005 --
NM_007315chr211357 ------
NM_007325chrX32001 836 753 ------
NM_007345chr1821744 697 ------
NM_007358chr121718 1593 ------
NM_007361chr14--132 ----
NM_007363chrX11031 ------
NM_007365chr111771 ------
NM_007373chr102690 554 ------
NM_007375chr132189 2031 1021 ------
NM_012064chr124805 787 283 189 142 ----
NM_012081chr533692 3151 2938 23007 1239 1953 --
NM_012083chr104957 899 339 75 1446 ----
NM_012097chr22649 313 ------
NM_012102chr112469 ------
NM_012141chr1323637 1108 ------
NM_012158chr1321260 163 ------
NM_012164chr965768 2230 968 743 648 176 --12507 --
NM_012188chr51882 ------
NM_012193chr1195173 5086 4963 4535 3767 3429 1904 490 353 14361 ----
NM_012197chr91152 1308 ----
NM_012199chr154553 4189 3346 951 423 11322 ----
NM_012210chr931498 1288 199 ------
NM_012215chr1051660 1615 1437 1367 223 1270 ----
NM_012218chr1962932 2637 2471 974 255 247 1778 2379 60 --
NM_012219chr322151 415 --2563 182 --
NM_012232chr1772171 2143 1882 1550 1534 375 76 --1756 --
NM_012234chr333429 1252 815 23077 2945 ----
NM_012238chr101335 ------
NM_012239chr1121133 164 ------
NM_012257chr71927 ------
NM_012259chr621246 891 1413 ----
NM_012262chr135013 3917 842 ------
NM_012287chr334261 3334 1394 ------
NM_012288chr654851 4616 2285 1050 699 15196 --13957
NM_012290chr231676 1645 1153 ------
NM_012293chr2125 ------
NM_012294chr783248 2654 2517 2490 1581 388 101 43 ------
NM_012297chr432590 2333 2020 11934 ----
NM_012309chr1164912 3606 947 904 664 238 ------
NM_012323chr2261566 1445 1294 1137 1131 1094 ------
NM_012327chr183491 401 168 ------
NM_012329chr1711498 ------
NM_012333chr11620 ------
NM_012334chr554141 3851 1794 1740 507 ------
NM_012339chr101588 ------
NM_012382chr534309 4125 2931 23422 1338 ----
NM_012388chr1543144 3080 2360 889 ------
NM_012416chr921113 495 1865 --11092
NM_012421chr11450 ------
NM_012434chr61301 ------
NM_012448chr1732077 2047 329 2795 261 ----
NM_013227chr15--1248 ----
NM_013230chrY31451 552 228 ------
NM_013231chr1433934 2975 2919 ------
NM_013233chr221029 195 ------
NM_013255chr7138565 8554 8243 6605 6249 6092 5641 5596 5352 2281 1859 970 961 16018 ----
NM_013261chr443772 3396 2959 1376 ------
NM_013267chr12143 ------
NM_013277chr122964 224 ------
NM_013281chr2011213 ------
NM_013286chr342998 2978 1271 665 ------
NM_013309chr1522614 810 ------
NM_013320chr121119 ------
NM_013322chr71296 11265 ----
NM_013354chr83394 304 33 ------
NM_013357chr81669 ------
NM_013372chr1512225 11169 ----
NM_013380chr191806 ------
NM_013411chr141952 1817 439 197 ------
NM_013433chr1911956 1556 ----
NM_013437chr8--2900 180 ----
NM_013449chr1232284 887 761 ------
NM_013989chr1454165 3827 1287 1155 744 44458 4038 115 23 ----
NM_014000chr102537 467 ------
NM_014001chr1721460 1069 ------
NM_014010chr91536 ------
NM_014011chr21395 22383 2133 ----
NM_014021chr143088 964 412 277 ------
NM_014023chr1042921 2285 602 96 21960 554 ----
NM_014039chr111179 21089 882 ----
NM_014071chr202197 65 ------
NM_014089chr131585 12199 ----
NM_014106chr1511067 ------
NM_014109chr811012 ------
NM_014112chr825021 570 ------
NM_014141chr733887 1843 205 1254 ----
NM_014216chr1441573 1486 1344 405 1255 ----
NM_014217chr121369 98 ------
NM_014231chr1242024 1384 731 469 ------
NM_014233chr1731507 626 347 ------
NM_014240chr353012 1184 970 498 351 --23452 915 --
NM_014282chr93431 160 147 ------
NM_014283chr12948 176 ------
NM_014294chr811399 ------
NM_014300chr151156 --1378 --
NM_014302chr7121 ------
NM_014305chr131168 ------
NM_014309chr2275166 5113 4866 4510 1679 1271 484 --12131 --
NM_014325chr1221446 214 ------
NM_014344chr11--1908 ----
NM_014363chr132918 211 11156 ----
NM_014383chr191269 ------
NM_014393chr831881 805 395 ------
NM_014400chr191473 ------
NM_014409chr1169 ------
NM_014415chr3--196 ----
NM_014423chr584756 3856 2176 1870 1259 1069 435 249 11294 ----
NM_014435chr41184 ------
NM_014447chr411091 ------
NM_014458chr1263 49 ------
NM_014462chr81102 1285 ----
NM_014480chr193793 655 630 ------
NM_014489chr111239 ------
NM_014494chr1652371 2314 2155 384 251 1539 ----
NM_014517chr351880 1611 1447 609 144 11689 ----
NM_014521chr231750 731 683 ------
NM_014554chr1222256 1728 11456 ----
NM_014574chr1421400 417 --11390 --
NM_014583chr31325 ------
NM_014586chr2194712 4500 4362 3904 3887 3875 1876 1802 548 --11081 --
NM_014607chr221712 549 ------
NM_014612chr911433 ------
NM_014614chr231058 602 106 ------
NM_014615chr1632316 1397 1264 32597 1048 506 ----
NM_014634chr2253551 3511 2761 1068 631 1793 ----
NM_014635chr231372 1287 466 11488 ----
NM_014646chr1862959 2003 1252 1192 276 29 ------
NM_014647chr1641702 1630 681 172 ------
NM_014655chr152169 465 382 350 220 ------
NM_014666chr511170 ------
NM_014667chr321716 50 --12034 --
NM_014677chr821190 243 ------
NM_014682chr851919 1808 590 514 333 21697 1506 ----
NM_014683chr17--11667 ----
NM_014685chr162223 99 ------
NM_014686chr1952138 1825 1665 912 247 ------
NM_014690chr73269 232 122 12818 ----
NM_014693chr3--1713 ----
NM_014701chr1531252 1221 407 ------
NM_014707chr712043 1312 ----
NM_014721chr656307 5904 2486 1516 680 27465 1499 ----
NM_014730chr1275139 4713 4617 3943 3874 1661 608 ------
NM_014730chr1275139 4713 4617 3943 3874 1661 608 ------
NM_014739chr634083 3650 946 ------
NM_014741chr1122134 1943 ------
NM_014742chr202449 216 ------
NM_014746chr243659 3136 2915 116 13549 ----
NM_014751chr811445 ------
NM_014755chr284095 3472 3039 3021 2947 2608 1349 1295 ------
NM_014756chr111383 ------
NM_014765chr152715 2465 2049 1886 691 ------
NM_014766chr723350 358 21351 1118 ----
NM_014767chr1083251 3218 3102 2990 1471 1396 1347 892 13378 ----
NM_014771chr162882 283 ------
NM_014772chr1873532 2665 2227 1201 666 436 319 ------
NM_014779chr341169 921 293 150 ------
NM_014781chr81508 ------
NM_014800chr71987 ------
NM_014807chr113860 738 27 ------
NM_014810chr111196 2510 308 ----
NM_014820chr321285 816 ------
NM_014824chr11152 ------
NM_014826chr163816 2736 1262 1186 845 391 1533 ----
NM_014827chr121053 400 ------
NM_014828chr1422229 82 11878 ----
NM_014830chr1271569 1441 1379 1282 1109 962 623 13354 ----
NM_014836chr1031800 1280 1242 1746 ----
NM_014840chr1221317 480 --12967 --
NM_014841chr64983 329 80 49 ------
NM_014850chr363879 3516 3425 1587 1504 552 --13630 --
NM_014868chr122826 100 --1692 --
NM_014874chr141849 1705 1189 450 1581 ----
NM_014876chr2241597 1554 870 595 ------
NM_014877chr1787219 6865 6757 6652 6154 5660 3074 2160 27528 1579 ----
NM_014893chrY1629 ------
NM_014902chr2031266 1179 73 ------
NM_014904chr1043291 1131 859 714 12606 ----
NM_014905chr241959 1664 1400 128 ------
NM_014906chr1722895 700 ------
NM_014909chr1462680 2474 791 595 561 219 ------
NM_014912chr1022353 1306 176 ----
NM_014914chr21483 ------
NM_014918chr152508 142 ------
NM_014924chr1462386 2364 2229 1179 705 468 12352 ----
NM_014925chr121283 ------
NM_014932chr31693 ------
NM_014939chr181597 21378 1364 ----
NM_014946chr232696 2617 571 ------
NM_014964chr173638 109 86 --1548 --
NM_014969chr11195 ------
NM_014982chr1445116 4854 1010 133 ------
NM_014988chr442413 508 399 90 ------
NM_014996chr32721 57 ------
NM_014999chr1221480 175 ------
NM_015000chr1222515 2146 ------
NM_015025chr21906 12455 ----
NM_015026chr121784 1293 ----
NM_015027chr1641846 1820 786 581 ------
NM_015032chr131858 ------
NM_015035chr2066059 5492 4626 1585 759 127 ------
NM_015039chr144356 4060 3495 3226 1917 ----
NM_015042chr1593982 3824 3627 3616 3359 3346 3023 2705 691 11451 ----
NM_015045chr10--1278 ----
NM_015051chr922500 2230 --12988 --
NM_015061chr92144 86 1809 ----
NM_015064chr1243252 1371 281 205 --13370 --
NM_015071chr5105870 5369 5200 4748 4695 4503 2002 1961 146 28 --12073 --
NM_015074chr164845 4537 4479 3759 3383 665 ------
NM_015076chr654426 3366 1785 1507 809 ------
NM_015090chr1146047 5759 5657 5070 4526 4436 4074 4028 2165 2071 794 646 640 237 --14223 --
NM_015092chr1633780 1730 1087 33573 2993 114 ----
NM_015094chr2274560 3728 3429 3137 3024 1534 151 ------
NM_015107chrX1774 ------
NM_015110chr921800 341 ------
NM_015113chr1731716 546 113 1810 ----
NM_015115chr411096 ------
NM_015130chr42315 72 ------
NM_015132chr731489 1216 425 170 ----
NM_015137chr832405 669 62 1699 ----
NM_015144chr1663187 2443 2429 964 938 195 191 1370 --
NM_015147chr252278 2125 2115 1264 468 1604 ----
NM_015149chr131359 685 620 ------
NM_015150chr31136 ------
NM_015155chr1063121 2639 2223 807 345 96 ------
NM_015158chr9199 ------
NM_015176chr121423 1221 11485 ----
NM_015184chr3--131 ----
NM_015185chrX42621 2336 904 548 ------
NM_015191chr1142167 1993 949 582 1981 ----
NM_015199chr331031 572 155 ------
NM_015200chr4--21901 321 ----
NM_015202chr1621059 470 11285 ----
NM_015203chr1157 ------
NM_015205chr1393994 3732 3695 3605 3461 3201 1123 1032 755 15007 ----
NM_015206chr1532573 1100 892 ------
NM_015213chr11--1168 ----
NM_015219chr1742596 2522 1833 89 11891 ----
NM_015225chr91733 --1580 --
NM_015226chr1643291 3272 2303 2256 ------
NM_015229chr1721194 771 ------
NM_015231chr112924 606 1261 1249 --
NM_015238chr51544 ------
NM_015239chr9--186 ----
NM_015265chr222131 1945 ------
NM_015267chr1211755 ------
NM_015272chr1621777 449 ------
NM_015277chr1831418 1404 1297 ------
NM_015278chr632414 1280 713 1419 ----
NM_015282chr273057 2920 2471 2045 2003 1986 702 ------
NM_015288chr573841 3816 2657 1193 961 713 149 ----1524
NM_015294chr171955 1393 ----
NM_015310chr866973 6761 6465 5678 1413 1310 46027 5510 5127 2547 ----
NM_015313chr1194428 4138 3223 3159 2925 1036 680 421 283 ------
NM_015315chr543350 2420 1013 23 12305 ----
NM_015317chr21874 ------
NM_015321chr19104617 4334 3577 3557 3523 3240 3213 899 803 107 --194 --
NM_015326chr152640 1964 963 823 723 11177 ----
NM_015328chr752174 2120 846 373 336 12035 ----
NM_015331chr11656 ------
NM_015335chr1232468 2188 1906 ------
NM_015336chr1222453 2066 ------
NM_015358chr211313 1438 ----
NM_015365chrX31225 676 496 ------
NM_015375chr164462 3989 3802 3352 1820 1392 1438 ----
NM_015382chr14--1237 1696 --
NM_015385chr1031983 1202 480 ------
NM_015387chr21340 1406 ----
NM_015388chr61117 ------
NM_015455chr553635 3164 2851 1560 1066 ------
NM_015458chr874120 2127 2017 1900 1806 1398 969 14562 ----
NM_015497chr15----1212 --
NM_015503chr162569 177 ------
NM_015508chr321367 588 ------
NM_015511chr2021181 938 1377 ----
NM_015525chr6142 ------
NM_015542chr103917 406 387 ------
NM_015548chr6------1107
NM_015550chr732955 2596 1177 ------
NM_015554chr1522218 828 22334 2123 ----
NM_015555chr621400 65 ------
NM_015564chr532840 2209 559 ------
NM_015568chr2064325 3660 3417 1141 989 273 23551 429 ----
NM_015570chr741586 1286 1229 417 --1623 --
NM_015571chr622268 2011 ------
NM_015576chr31165 ------
NM_015590chr11703 ------
NM_015602chr131639 1357 1108 ------
NM_015626chr1731233 817 148 ------
NM_015630chr21964 ------
NM_015635chr92721 157 1643 ----
NM_015646chr1221264 222 ------
NM_015678chr1311553 ------
NM_015680chr22224 40 1130 ----
NM_015694chr71119 ------
NM_015695chr631397 273 127 11512 ----
NM_015834chr211908 ------
NM_015850chr832073 345 337 ------
NM_015852chr723584 244 ------
NM_015874chr41503 ------
NM_015879chr1877222 7051 6775 2100 1618 1475 158 26427 539 ----
NM_015885chr111184 ------
NM_015902chr8--1152 ----
NM_015912chr831771 297 51 ------
NM_015995chr1555238 5116 1709 549 332 --1933 --
NM_015999chr11576 ------
NM_016009chr11189 21176 905 ----
NM_016018chr822437 525 ------
NM_016021chr633025 2554 23 ------
NM_016022chr12910 737 ------
NM_016040chr122477 981 ------
NM_016070chr17160 ------
NM_016072chr1212069 1119 ----
NM_016107chr51504 ------
NM_016120chrX11161 ------
NM_016131chr222247 2225 11644 ----
NM_016132chr1512279 13418 ----
NM_016156chr11--22201 146 ----
NM_016206chr3118668 8370 6834 2716 2699 2693 2451 2087 1793 1104 851 ------
NM_016213chr15137 ------
NM_016216chr3154 ------
NM_016217chr663039 2836 1464 954 879 326 ------
NM_016227chr12948 176 ------
NM_016231chr1741413 637 495 300 ------
NM_016234chr101756 ------
NM_016235chr1641494 1315 971 583 ------
NM_016239chr172774 754 ------
NM_016248chr1333398 3040 2632 13157 ----
NM_016260chr256638 5274 5069 4803 382 ------
NM_016284chr162944 55 ------
NM_016289chr251493 870 499 460 200 ------
NM_016300chr31439 ------
NM_016306chr31255 ------
NM_016308chr121975 1892 ------
NM_016319chr121716 ------
NM_016329chr3121 ------
NM_016357chr121892 2852 399 ----
NM_016376chr1753110 2789 1597 551 430 ------
NM_016377chr6--11766 ----
NM_016422chr1153087 2499 2376 1020 785 23223 2315 ----
NM_016423chr14--2315 34 ----
NM_016436chr2031792 482 57 1364 ----
NM_016441chr231709 774 294 ------
NM_016448chr141876 1567 52 27 ------
NM_016467chr21214 11339 ----
NM_016507chr1721066 487 ------
NM_016522chr111231 21448 1159 ----
NM_016525chr91165 ------
NM_016531chr453217 2783 1127 819 574 ------
NM_016542chrX187 ------
NM_016544chr243737 3164 541 79 ------
NM_016545chr11184 2769 690 ----
NM_016578chr111653 ------
NM_016605chr542002 1053 786 527 12394 ----
NM_016621chr1174517 4383 3455 2897 2811 453 161 ------
NM_016622chr2--22170 2116 ----
NM_016626chr1821747 1184 1378 ----
NM_016628chr10174 1273 ----
NM_016654chr151140 ------
NM_016824chr1011175 ------
NM_016932chr2122 ------
NM_016936chr1641921 1707 864 271 ------
NM_016950chr41190 ------
NM_016953chr282294 1571 1446 678 508 380 323 136 16157 ----
NM_017423chr421632 576 ------
NM_017447chr2121693 1187 13615 ----
NM_017452chr2021258 177 ------
NM_017453chr2021258 177 ------
NM_017454chr2021258 177 ------
NM_017510chr52674 534 1564 ----
NM_017551chr1061782 725 713 625 493 53 ------
NM_017553chr1521078 935 ------
NM_017563chr3106217 5918 4123 2540 1947 1922 1574 1414 1084 353 24504 4485 ----
NM_017569chr131102 ------
NM_017582chr111786 ------
NM_017594chr932566 2500 2351 ------
NM_017596chr143369 2892 423 80 ------
NM_017612chr121163 ------
NM_017626chr1041706 1469 689 578 ------
NM_017629chr121900 548 11533 ----
NM_017635chr111487 ------
NM_017637chr9108624 8608 8061 7713 6888 6189 3449 3013 2253 1706 29043 3568 ----
NM_017649chr103957 387 87 ------
NM_017658chr14--1750 ----
NM_017660chr1953183 3142 405 244 29 ------
NM_017661chr15167 ------
NM_017670chr112825 260 ------
NM_017679chr171581 ------
NM_017693chr1321257 1170 ------
NM_017694chr231999 1437 718 1799 --1691
NM_017709chr154294 3908 2922 1249 307 22625 1668 ----
NM_017714chr202712 50 ------
NM_017715chr74728 644 563 269 ------
NM_017724chr31101 ------
NM_017742chr1811755 11815 ----
NM_017745chrX1652 ------
NM_017753chr91423 ------
NM_017754chr661877 817 776 468 433 219 13666 ----
NM_017762chr153995 921 563 ------
NM_017778chr81205 ------
NM_017798chr2031002 984 814 ------
NM_017810chr16151 ------
NM_017811chr932484 1125 1081 ------
NM_017813chr835584 5147 1964 15123 ----
NM_017824chr1031059 780 611 ------
NM_017830chr44872 722 80 30 ------
NM_017845chr4--1593 ----
NM_017848chrX44576 3721 1451 1241 ------
NM_017893chr1021229 1124 ------
NM_017902chr1055398 5038 3638 1660 1203 ------
NM_017907chr112445 423 ------
NM_017919chr934303 1458 920 11527 ----
NM_017929chr2221265 1236 ------
NM_017944chr1142460 1995 1987 34 11165 ----
NM_017948chr91476 ------
NM_017988chr122179 53 ------
NM_017998chr92970 519 ------
NM_018000chr221788 100 ------
NM_018015chrX2158 111 2919 719 ----
NM_018017chr1032636 482 293 11073 ----
NM_018024chr81483 ------
NM_018031chr31565 ------
NM_018043chr11--1955 ----
NM_018046chr521906 1308 21328 236 ----
NM_018050chr12160 ------
NM_018078chr42708 419 ------
NM_018086chr22421 183 193 ----
NM_018105chr82883 70 ------
NM_018110chr1631278 1211 455 ------
NM_018115chr42741 290 ------
NM_018117chr102261 112 ------
NM_018178chr141490 386 149 68 ------
NM_018181chr1821853 196 1187 ----
NM_018182chr1731895 1854 865 ------
NM_018184chr321585 254 1123 ----
NM_018193chr152231 35 1446 ----
NM_018201chr942518 2421 2262 1892 ------
NM_018202chr11329 ------
NM_018211chr121541 373 ------
NM_018214chr611119 ------
NM_018243chr43800 585 404 1872 ----
NM_018244chr201148 ------
NM_018247chr622414 1964 ------
NM_018313chr352687 2537 2034 1026 279 1422 ----
NM_018327chr201676 ------
NM_018334chr7----1383 --
NM_018364chr111067 13137 ----
NM_018370chr1232089 1516 141 12218 ----
NM_018373chr1456105 4488 4333 2039 1661 14074 ----
NM_018383chr231944 1413 716 ------
NM_018388chrX21420 333 11018 ----
NM_018398chr31224 ------
NM_018403chr322504 88 --1425 --
NM_018424chr92701 339 ------
NM_018429chr522408 134 11028 ----
NM_018439chr1822154 467 ------
NM_018441chr21595 ------
NM_018442chr13283 112 78 ------
NM_018444chr811840 ------
NM_018448chr1221227 516 ------
NM_018471chr2145 ------
NM_018475chr42178 123 ------
NM_018557chr221344 139 ------
NM_018566chr134877 3582 2020 24472 1836 ----
NM_018571chr2--1676 ----
NM_018584chr11820 ------
NM_018590chr10--11636 ----
NM_018602chr1521722 1309 ------
NM_018638chr1225012 1204 ------
NM_018640chr1222632 451 12733 ----
NM_018650chr131594 684 639 11820 ----
NM_018652chr152850 691 --1334 --
NM_018657chr33803 245 201 ------
NM_018660chr852987 2500 2024 465 115 ------
NM_018667chr1611052 --1276 --
NM_018685chr711155 ------
NM_018695chr51701 ------
NM_018698chrX2363 178 11695 ----
NM_018703chr161157 1265 ----
NM_018712chr111260 ------
NM_018717chr41690 ------
NM_018840chr202454 361 ------
NM_018847chr91309 ------
NM_018898chr522221 395 ------
NM_018899chr522221 395 ------
NM_018900chr522221 395 ------
NM_018901chr522221 395 ------
NM_018902chr522221 395 ------
NM_018903chr522221 395 ------
NM_018904chr522221 395 ------
NM_018905chr522221 395 ------
NM_018906chr522221 395 ------
NM_018907chr522221 395 ------
NM_018908chr522221 395 ------
NM_018909chr522221 395 ------
NM_018910chr522221 395 ------
NM_018911chr522221 395 ------
NM_018945chr633655 3532 2291 1932 ----
NM_018970chr712794 1593 ----
NM_018977chrX21037 411 ------
NM_018983chr41256 ------
NM_018999chr1023043 1556 24001 3755 ----
NM_019001chr333749 3521 886 24842 1408 ----
NM_019027chr432089 1820 998 ------
NM_019046chr102847 744 ------
NM_019063chr21719 12002 ----
NM_019074chr152891 657 ------
NM_019106chr2232582 1016 526 ------
NM_019114chr942415 2383 1995 194 --2381 64 --
NM_019116chr1673150 2997 2911 2741 2291 852 574 ------
NM_019558chr21273 ------
NM_019597chrX1187 ------
NM_019605chr1----1183 --
NM_019610chr111946 ------
NM_019613chr1731167 352 93 ------
NM_019891chr111302 ------
NM_019903chr1011175 ------
NM_020116chr411585 ------
NM_020117chr52972 821 ------
NM_020122chr255384 4836 3716 985 399 ------
NM_020141chr121829 621 ------
NM_020148chr1882995 2276 2267 2044 885 771 102 68 ------
NM_020150chr103554 414 28 ------
NM_020152chr21--1138 ----
NM_020156chr71165 1451 ----
NM_020168chr1521308 906 ------
NM_020178chr1731025 945 809 ------
NM_020179chr111105 ------
NM_020182chr2061086 940 298 237 185 21 --21381 777 --
NM_020184chr242254 2238 664 626 ------
NM_020189chr81187 ------
NM_020193chr1111129 ------
NM_020199chr511155 1189 ----
NM_020204chr11268 1174 ----
NM_020226chr42569 265 ------
NM_020245chr634915 3893 3117 24671 1919 ----
NM_020336chr2053564 3025 2682 2628 2581 1110 ----
NM_020341chr201538 11984 ----
NM_020342chr21665 11626 ----
NM_020346chr111285 ------
NM_020357chr31153 ------
NM_020379chr1--1649 ----
NM_020390chr323256 1011 ------
NM_020429chr722686 328 ------
NM_020432chr721672 1646 ------
NM_020443chr1116839 5925 5370 5298 4334 2344 2214 2112 1904 1422 316 11055 11214 --
NM_020449chrX2669 299 ------
NM_020452chr122079 1587 ------
NM_020463chr231376 594 60 1147 ----
NM_020474chr1821776 702 ------
NM_020478chr842336 1963 461 353 ------
NM_020645chr111456 ------
NM_020648chr181413 12793 ----
NM_020649chr17153 ------
NM_020651chr21221 ------
NM_020673chr2056593 6292 5848 2180 1291 15709 ----
NM_020704chr712550 ------
NM_020708chr203859 671 602 ------
NM_020715chr1411439 11913 ----
NM_020718chr1645815 5431 5279 4709 12433 ----
NM_020737chr6181 ------
NM_020739chr1543781 3657 2679 41 13587 ----
NM_020748chr1731639 388 234 ------
NM_020752chr1012385 ------
NM_020755chr6--21503 252 ----
NM_020766chrX34158 113 58 23497 3194 ----
NM_020771chr611410 ------
NM_020772chr1767403 7380 6882 2457 2059 1145 ------
NM_020774chr1884696 3883 2483 2408 2010 1941 1596 872 ------
NM_020792chr322391 115 ------
NM_020796chr532734 887 831 ------
NM_020801chr511962 ------
NM_020802chr1162828 2484 2200 998 899 730 ------
NM_020808chr131003 391 330 1304 ----
NM_020813chr1962235 2106 1030 527 513 273 ------
NM_020824chr102546 513 ------
NM_020830chr22293 280 ------
NM_020841chr121202 23791 3450 ----
NM_020850chr164990 639 360 350 12287 ----
NM_020859chr433610 3029 571 43298 3194 1572 1305 11312 --
NM_020868chr221923 407 ------
NM_020872chr311267 2531 264 ----
NM_020888chr141876 1788 1333 344 ------
NM_020899chr1732288 2264 775 11585 ----
NM_020918chr1052849 1038 976 929 779 1284 ----
NM_020921chr143298 163 117 33617 1107 516 ----
NM_020922chrX21819 1435 1114 ----
NM_020927chr1652336 2110 1546 683 132 ------
NM_020935chr264642 4338 4059 2985 1598 1089 ------
NM_020947chr1642084 1971 1694 1470 --12049 --
NM_020948chr153626 3325 2610 713 440 1636 ----
NM_020951chr1932095 1820 238 ------
NM_020956chr1974218 3873 3816 3067 2892 1399 678 ------
NM_020962chr152275 118 ------
NM_020971chr191269 ------
NM_020981chr2--1562 ----
NM_021003chr14--126 ----
NM_021005chr15--11031 ----
NM_021007chr211531 1615 ----
NM_021012chr1783143 2844 2136 1060 776 766 647 268 ------
NM_021020chr863070 2840 2298 1363 1279 470 ------
NM_021047chr191259 186 ----
NM_021061chr843863 1117 957 829 13770 ----
NM_021069chr44833 747 641 601 ------
NM_021072chr522484 818 ------
NM_021079chr1733242 2121 2081 ------
NM_021083chrX53578 942 547 480 123 23431 335 ----
NM_021090chr2243427 3219 1251 305 ------
NM_021096chr2293007 2770 2455 2187 2060 1045 776 365 140 1311 ----
NM_021140chrX3861 845 200 ------
NM_021145chr73976 224 188 1432 ----
NM_021148chr742394 857 190 95 ------
NM_021155chr1962695 976 593 197 185 159 ------
NM_021159chr441373 1269 1126 244 ------
NM_021161chr141480 ------
NM_021188chr144429 411 347 170 ------
NM_021190chr121317 86 ------
NM_021191chr1222183 66 ------
NM_021192chr21367 ------
NM_021202chr2042470 1018 71 53 22059 886 ----
NM_021205chr112472 1182 ----
NM_021215chr2041584 522 425 404 ------
NM_021218chr93972 820 697 ------
NM_021238chr122800 101 ------
NM_021239chr1431378 1215 1013 1469 ----
NM_021249chr1421455 1395 ------
NM_021619chr921144 954 ------
NM_021625chr121398 ------
NM_021627chr34957 906 219 118 ------
NM_021649chr52740 211 1688 ----
NM_021722chr71105 ------
NM_021724chr171293 ------
NM_021728chr141763 ------
NM_021738chr101115 ------
NM_021794chr11279 ------
NM_021813chr645205 1562 1172 868 ------
NM_021818chr1421467 36 ----1613
NM_021821chr122844 164 ------
NM_021908chr71825 ------
NM_021914chr142693 37 12396 ----
NM_021923chr411489 ------
NM_021932chr112753 604 ------
NM_021934chr121298 ------
NM_021949chrX2735 694 --173 --
NM_021951chr9--3698 221 137 ----
NM_021961chr1146896 2849 2609 2452 12159 ----
NM_021964chr335992 5782 2253 15833 ----
NM_021977chr653743 3529 3287 1167 1022 ------
NM_021984chrX21122 110 ------
NM_021987chrX21122 110 ------
NM_021990chrX21122 110 ------
NM_021998chrX11041 1355 ----
NM_022041chr1631095 152 104 ------
NM_022048chr1565499 5217 2063 1387 911 396 11757 ----
NM_022064chr32176 72 ------
NM_022066chr171139 --1197 --
NM_022085chr631249 552 403 ------
NM_022091chr641939 1888 1832 1810 12069 ----
NM_022114chr143979 3645 1340 573 ------
NM_022121chr611082 ------
NM_022130chr531339 973 341 ------
NM_022136chr212497 57 ------
NM_022138chr61138 ------
NM_022166chr1676214 4842 4695 2394 2069 2040 988 ------
NM_022171chr321267 198 ------
NM_022340chr373511 1402 1172 1112 989 749 469 1602 ----
NM_022373chr71183 ------
NM_022459chr1314501 26305 6265 ----
NM_022463chr1731457 430 352 ------
NM_022465chr1242936 2110 1165 86 ------
NM_022469chr152861 2561 2531 629 179 ------
NM_022470chr321217 792 2972 456 ----
NM_022474chr1411926 ------
NM_022477chr2021645 1285 ------
NM_022483chr541877 1486 1333 223 ------
NM_022497chr322782 182 ------
NM_022648chr243129 970 902 43 ------
NM_022650chr51126 ------
NM_022735chr121357 265 ------
NM_022748chr751123 717 708 699 690 ------
NM_022763chr31632 ------
NM_022768chr11368 1128 ----
NM_022802chr1021618 284 ------
NM_022824chr531486 319 186 ------
NM_022826chr2--1815 ----
NM_022831chr111136 1373 ----
NM_022845chr1621915 846 ------
NM_022893chr21604 1977 ----
NM_022898chr1434537 3242 2965 ------
NM_022912chr21860 22698 1019 ----
NM_022965chr431361 1305 116 ------
NM_022977chrX31785 678 456 ------
NM_023037chr131129 11065 ----
NM_023076chr1622256 922 ------
NM_023105chr832073 345 337 ------
NM_023106chr832073 345 337 ------
NM_023110chr832073 345 337 ------
NM_023111chr832073 345 337 ------
NM_023923chr133479 2316 245 ------
NM_023929chr832843 494 432 1316 ----
NM_024016chr171195 ------
NM_024019chr42314 196 21060 225 ----
NM_024043chr1641411 1193 1165 1015 11047 ----
NM_024045chr10131 ------
NM_024050chr191171 ------
NM_024052chr1733077 2063 784 ------
NM_024061chr71635 ------
NM_024069chr19--1666 ----
NM_024082chrX1137 ------
NM_024092chr1121019 46 ------
NM_024094chr8------1567
NM_024295chr851960 1542 1266 734 324 ------
NM_024336chr162363 250 ------
NM_024345chr945065 1369 795 395 11865 ----
NM_024408chr11852 ------
NM_024415chr5166 ------
NM_024519chr162290 232 ------
NM_024524chr321067 64 12280 ----
NM_024539chrX--1892 ----
NM_024545chr22510 189 ------
NM_024569chr11945 1475 ----
NM_024594chr521594 241 ------
NM_024595chr11304 ------
NM_024638chr33570 546 88 12295 ----
NM_024639chr62310 238 ------
NM_024665chr31181 11654 ----
NM_024675chr16164 ------
NM_024692chr221367 670 ------
NM_024704chr2041117 749 169 54 ------
NM_024709chr142340 2332 1996 177 1543 ----
NM_024721chr822011 581 ------
NM_024755chr151728 ------
NM_024757chr92433 291 ------
NM_024770chr275429 5389 4200 981 869 709 135 16458 ----
NM_024772chr1--1439 ----
NM_024828chr921585 1208 ------
NM_024835chr171325 ------
NM_024837chr1531669 1654 74 ------
NM_024847chr1621264 176 1122 --1324
NM_024896chr942056 843 609 124 ------
NM_024900chr431574 572 178 22210 449 ----
NM_024900chr431574 572 178 22210 449 ----
NM_024920chr411136 11589 ----
NM_024921chrX31635 1490 1441 ------
NM_024930chr542790 1878 535 106 12209 ----
NM_024949chr444508 4466 1839 824 11006 ----
NM_024953chr121401 ------
NM_024989chr222964 575 --17341 --
NM_024991chr1031983 1202 480 ------
NM_025054chr813340 2957 832 ----
NM_025074chr43689 421 152 ------
NM_025076chr22523 497 ------
NM_025083chr1551804 1304 579 395 198 ------
NM_025133chr21416 ------
NM_025135chr18--1520 ----
NM_025146chr332309 2115 151 ------
NM_025154chr711556 ------
NM_025160chr124283 1638 13973 ----
NM_025179chr154450 3720 763 278 101 ------
NM_025181chr21766 ------
NM_025187chr1621041 492 ------
NM_025221chr41162 ------
NM_025227chr201316 ------
NM_025235chr101414 11931 ----
NM_025238chr1511608 11144 ----
NM_025250chr772968 2544 2213 2040 1868 1064 839 12402 ----
NM_030594chr1531225 938 181 ------
NM_030625chr1011690 ------
NM_030647chr734657 263 66 15001 ----
NM_030648chr445476 5178 1507 1322 ------
NM_030650chr233980 3663 1508 11531 ----
NM_030660chr1421268 1006 ------
NM_030664chr1011551 ------
NM_030758chr2241478 1106 1090 582 ------
NM_030762chr121393 ------
NM_030777chr2052498 1847 944 744 673 12345 ----
NM_030780chr81260 1346 ----
NM_030784chr6--1370 ----
NM_030802chr17--1813 1845 --
NM_030806chr177381 7015 6982 6901 6745 3665 497 11214 ----
NM_030810chr631249 552 403 ------
NM_030816chr123245 775 33231 1400 1278 2471 175 --
NM_030885chr32515 95 ------
NM_030906chr11197 ------
NM_030915chr242179 1801 1482 147 ------
NM_030918chr155228 5222 4510 4316 72 ------
NM_030939chr6--188 ----
NM_030940chr911390 ------
NM_030949chr61471 ------
NM_030958chr81360 ------
NM_030963chr6--1662 ----
NM_030965chr11537 ------
NM_030978chr92379 346 ------
NM_030981chr1111236 ------
NM_031284chr152860 627 ------
NM_031314chr1411733 ------
NM_031372chr411641 ------
NM_031411chr522221 395 ------
NM_031427chr1435948 5888 2161 ------
NM_031439chr82427 240 ------
NM_031442chrX13144 ------
NM_031468chr777900 6871 2751 2716 2338 1076 486 11233 ----
NM_031483chr2022572 2276 11043 1472 --
NM_031492chr112126 40 ------
NM_031844chr133673 3421 3412 11330 ----
NM_031845chr263356 2879 2867 1084 614 45 12779 ----
NM_031847chr263356 2879 2867 1084 614 45 12779 ----
NM_031849chr522221 395 ------
NM_031857chr522221 395 ------
NM_031860chr522221 395 ------
NM_031866chr102933 767 ------
NM_031886chr1982606 2084 1011 905 885 720 608 325 1672 ----
NM_031922chr61421 ------
NM_032012chr984243 4213 3490 3479 1595 453 174 53 ------
NM_032013chr2021645 1285 ------
NM_032017chr11665 --1429 --
NM_032021chr112991 847 ------
NM_032042chr552694 2289 973 225 214 1719 12787 --
NM_032102chr1142992 2525 1911 652 13081 ----
NM_032121chrX41832 1085 923 703 ------
NM_032125chr11926 ------
NM_032144chr221468 1318 ------
NM_032153chr31566 --1461 --
NM_032165chr121246 ------
NM_032174chr121469 461 ------
NM_032182chr1031322 1135 566 11204 ----
NM_032189chr1393796 3534 3497 3407 3263 2033 925 834 557 14809 ----
NM_032199chr1033419 1434 46 1924 13035 --
NM_032221chr201407 ------
NM_032228chr1111154 ------
NM_032233chr141787 ------
NM_032236chr121108 52 --1359 --
NM_032246chr1521274 151 11145 ----
NM_032271chr1611235 ------
NM_032291chr11282 ------
NM_032316chr342420 2159 585 179 1157 ----
NM_032319chr2141 ------
NM_032320chr111780 1531 ----
NM_032364chr122344 65 ------
NM_032373chr1035382 5144 4526 ------
NM_032382chr162484 30 ------
NM_032438chr63286 232 179 ------
NM_032440chr102814 420 12356 ----
NM_032446chr5--43872 3101 2830 2462 ----
NM_032449chr142187 1939 145 93 1133 ----
NM_032451chr16169 ------
NM_032452chr143596 476 273 ------
NM_032457chr463263 2995 2515 1542 1499 1446 ------
NM_032458chrX42934 1365 947 513 ------
NM_032486chr1652241 2154 1932 85 34 11864 ----
NM_032499chr151163 ------
NM_032505chr32573 101 ------
NM_032521chr2033049 3019 2645 1716 ----
NM_032547chr441275 1136 955 562 ------
NM_032552chr951840 567 529 419 307 ------
NM_032558chr911092 ------
NM_032560chr142828 212 ------
NM_032569chr1631314 574 229 --1365 --
NM_032575chr1641981 1807 1590 768 ------
NM_032590chr124852 319 68 33 1312 ----
NM_032632chr1421957 731 ------
NM_032638chr33988 565 385 ----11250
NM_032682chr31377 11315 ----
NM_032711chr1783782 3723 2986 2739 2712 1451 415 160 1974 1506 --
NM_032772chr101380 ------
NM_032777chr831617 1470 29 --1473 --
NM_032778chr333230 2103 342 ----1645
NM_032780chr111901 ------
NM_032793chr11352 ------
NM_032818chr922300 1922 ------
NM_032826chr755400 5286 971 572 90 11938 ----
NM_032846chr141428 ------
NM_032864chr121497 159 ------
NM_032873chr1113138 22993 1249 ----
NM_032876chr1431992 1474 582 1240 ----
NM_032884chr11362 ------
NM_032900chr1073789 2577 2445 1542 1250 539 284 ------
NM_032906chr41811 ------
NM_032960chr121063 272 ------
NM_032967chrX3792 397 386 ------
NM_032971chrY3819 424 413 ------
NM_032972chrY3819 424 413 ------
NM_032993chr41256 ------
NM_033016chr2241576 1478 1379 332 ------
NM_033025chr193264 123 105 ------
NM_033055chr12918 337 ------
NM_033089chr2021313 1013 ----1150
NM_033132chr131192 1617 ----
NM_033211chr511339 1498 ----
NM_033224chr7108050 7814 6686 6613 6504 6208 5946 1726 1094 85 17380 ----
NM_033226chr163602 187 129 ------
NM_033274chr571142 695 530 440 405 101 34 12412 1689 --
NM_033285chr833364 2978 2739 ------
NM_033296chr43820 671 177 --1291 --
NM_033315chr1732165 641 21 ------
NM_033326chr1121898 178 ------
NM_033331chr942889 2720 173 153 ------
NM_033360chr1251159 1145 582 387 321 ------
NM_033389chr1723045 1894 1967 ----
NM_033394chr211526 ------
NM_033397chr1031774 449 31 --1104 --
NM_033407chr11530 ------
NM_033420chr1931027 751 25 ------
NM_033421chr2041551 554 179 163 ------
NM_033429chr1551169 815 791 751 400 13133 ----
NM_033505chr256462 6317 4792 2457 760 25360 274 16424 --
NM_033551chr543350 2420 1013 23 12305 ----
NM_033642chrX1193 ------
NM_033656chr2175635 5318 5282 5001 4989 981 265 25815 5726 ----
NM_052832chr822850 991 22213 2194 ----
NM_052845chr1242756 2585 62 21 ------
NM_052879chr1243772 3597 3481 3012 ------
NM_052897chr121822 ------
NM_052899chr5----128 --
NM_052900chr84724 547 432 189 ------
NM_052904chr621294 905 --1414 --
NM_052905chr21153 ------
NM_052918chr1043020 771 644 631 13030 ----
NM_052925chr191926 --1324 --
NM_052927chr552211 1788 1732 1455 79 11530 ----
NM_052937chr811979 12138 ----
NM_053016chr9106282 6129 6102 2959 2942 2599 2527 2257 1242 633 ------
NM_053023chr111533 ------
NM_053024chr311216 ------
NM_053064chr1452336 1054 414 56 33 12405 ----
NM_053279chr852746 2312 1962 1084 41 ------
NM_057161chr62500 349 ------
NM_058170chr131354 1284 155 1252 ----
NM_058172chr41395 ------
NM_058241chr211932 11595 ----
NM_058241chr211932 11595 ----
NM_078476chr631663 366 63 ------
NM_080544chr331186 994 950 11028 ----
NM_080599chr103917 406 387 ------
NM_080629chr1----11487 --
NM_080630chr1----11487 --
NM_080671chr23864 726 422 ------
NM_080738chr121425 1267 190 ----
NM_080743chr632319 1860 98 ------
NM_080759chr13--1867 ----
NM_080760chr13--1867 ----
NM_080792chr2021478 743 12219 ----
NM_080867chr1443533 1377 931 479 ----1189
NM_080872chr833830 412 304 22746 982 ----
NM_100264chr10174 1273 ----
NM_100486chr10174 1273 ----
NM_130385chr1153214 2433 919 825 542 ------
NM_130391chr911341 ------
NM_130392chr911341 ------
NM_130393chr911341 ------
NM_130434chr151369 1779 ----
NM_130438chr212597 545 ------
NM_130439chr102479 394 ------
NM_130439chr102479 394 ------
NM_130442chr71987 ------
NM_130798chr1531288 610 538 21157 76 ----
NM_130811chr201250 ------
NM_130830chr373247 3197 1088 1066 908 261 91 ------
NM_130838chr1521421 584 ------
NM_130839chr1521421 584 ------
NM_130846chr123807 357 79 ------
NM_133170chr20127536 7377 6326 6310 6301 6020 5624 2279 965 794 590 318 16592 12020 --
NM_133171chr2031265 972 163 ------
NM_133264chr1743642 3133 2646 481 ------
NM_133265chrX53608 3414 2971 2902 534 ------
NM_133266chr111349 ------
NM_133334chr431836 515 305 ------
NM_133367chr61160 ------
NM_133369chr51394 ------
NM_133372chr562695 2497 2450 2370 1827 303 ------
NM_133433chr5--1340 ----
NM_133445chr933709 2966 1377 ------
NM_133486chrX1362 ------
NM_133625chr31251 1282 ----
NM_133646chr285302 5120 4856 4757 4736 4248 4151 4012 ------
NM_133647chr151137 12467 ----
NM_134265chr1731233 817 148 ------
NM_134424chr1211035 ------
NM_134442chr22397 354 ------
NM_138270chrX23025 1155 ------
NM_138288chr1431716 763 372 ------
NM_138316chr101175 11251 ----
NM_138317chr141480 ------
NM_138318chr141480 ------
NM_138319chr1511222 ------
NM_138346chr11158 ------
NM_138348chr5146327 5891 5475 5414 4887 4353 2643 2536 2468 2294 1434 809 497 61 44842 4778 2461 983 ----
NM_138369chr51468 ------
NM_138370chr2150 1186 1732 --
NM_138391chr11267 ------
NM_138426chr722328 2035 ------
NM_138444chr1343027 1591 1498 537 ------
NM_138473chr1243657 1659 1189 1065 11198 ----
NM_138569chr61117 ------
NM_138576chr1434537 3242 2965 ------
NM_138619chr1721460 1069 ------
NM_138620chr92102 64 ------
NM_138633chr6--11766 ----
NM_138638chr142693 37 12396 ----
NM_138713chr1667903 7714 6394 2291 2102 246 16990 ----
NM_138714chr1667903 7714 6394 2291 2102 246 16990 ----
NM_138731chr1433898 3802 1231 ------
NM_138735chr21489 ------
NM_138766chr51177 ------
NM_138771chr71271 ------
NM_138782chr532285 1831 492 12114 ----
NM_138795chr121406 59 ------
NM_138799chr222055 81 1658 ----
NM_138821chr51177 ------
NM_138822chr51177 ------
NM_138967chr1542444 1751 888 444 ------
NM_138970chr1412308 12038 129 --
NM_138981chr41818 ------
NM_139071chr1241686 1204 647 387 ------
NM_139072chr21107 --1576 --
NM_139076chr431450 1029 82 ------
NM_139135chr12943 322 ------
NM_139136chr1221119 871 ------
NM_139168chr511599 11302 ----
NM_139215chr17159 ------
NM_139244chr62743 610 ------
NM_144567chr152446 1973 840 770 206 1681 ----
NM_144571chr445957 2716 1405 654 ------
NM_144576chr122616 520 ------
NM_144578chr1454963 4584 3777 590 463 15320 ----
NM_144586chr22795 78 ------
NM_144590chr103742 338 151 1627 ----
NM_144598chr151132 ------
NM_144628chr2042905 840 235 107 ------
NM_144636chr31552 ------
NM_144642chr31352 ------
NM_144643chr41339 ------
NM_144690chr19--1362 ----
NM_144723chr52686 575 ------
NM_144728chr1--1307 ----
NM_144729chr1--1307 ----
NM_144778chr131717 11004 ----
NM_144949chr21395 22383 2133 ----
NM_144965chr9145 1140 ----
NM_144967chrX11027 ------
NM_144997chr1741066 880 421 83 ------
NM_145021chr101282 ------
NM_145024chr16177 ------
NM_145037chr331617 1181 511 1152 1571 11141
NM_145055chr1821136 576 ------
NM_145063chr62458 178 ------
NM_145185chr1921717 721 1668 ----
NM_145206chr1042807 2636 1208 364 ------
NM_145274chr17--2852 131 ----
NM_145307chr1032955 1803 1552 14171 ----
NM_145309chr11172 ------
NM_145320chr732955 2596 1177 ------
NM_145321chr732955 2596 1177 ------
NM_145322chr732955 2596 1177 ------
NM_145644chr2--2412 358 ----
NM_145686chr273025 2699 2565 2554 2080 1343 612 12654 ----
NM_145687chr273025 2699 2565 2554 2080 1343 612 12654 ----
NM_145733chr221371 ------
NM_145753chr341665 496 468 108 ------
NM_145799chrX32252 927 50 11106 ----
NM_145802chrX3911 684 391 ------
NM_145861chr121425 1267 190 ----
NM_145891chr161241 1453 ----
NM_145892chr161241 1453 ----
NM_145893chr161363 1575 ----
NM_145912chr22104574 4165 2885 1869 1675 1272 674 398 289 26 ------
NM_147150chr944008 3768 3046 1456 ------
NM_147156chr1011065 ------
NM_147181chr41162 ------
NM_147182chr41162 ------
NM_147183chr41162 ------
NM_147189chr83938 239 85 ------
NM_147204chr121398 ------
NM_147223chr22604 340 ------
NM_147233chr22421 157 ------
NM_148918chr17183 ------
NM_148921chr173638 109 86 --1548 --
NM_148977chr101175 11251 ----
NM_148978chr101175 11251 ----
NM_152221chr2221232 139 --1444 --
NM_152233chr1421455 1395 ------
NM_152240chr321217 792 2972 456 ----
NM_152261chr1232181 892 761 ------
NM_152267chr221149 1349 ----
NM_152277chr541977 1635 737 627 11994 ----
NM_152280chr141113 745 268 249 ------
NM_152284chr83670 644 36 ------
NM_152300chr1721476 585 ------
NM_152330chr1432535 2080 1711 1754 ----
NM_152342chr162530 87 ------
NM_152345chr171450 ------
NM_152384chr22588 125 ------
NM_152388chr233986 3197 741 ------
NM_152409chr563628 3535 3302 3216 457 100 ------
NM_152410chr6--1392 ----
NM_152414chr821401 1029 ------
NM_152424chrX74594 3935 1487 1382 1334 885 136 21159 558 ----
NM_152437chr1222229 804 --22411 2303 --
NM_152455chr151449 11131 1720 --
NM_152470chr181524 13802 ----
NM_152493chr12577 254 ------
NM_152512chr222426 387 ------
NM_152519chr21848 ------
NM_152542chr431936 829 23 --1463 --
NM_152556chr71129 1871 ----
NM_152581chrX31377 1275 416 ------
NM_152594chr151943 126 ----
NM_152605chr19--21408 464 ----
NM_152621chr41253 ------
NM_152622chr513151 ------
NM_152624chr585931 4969 2953 1209 670 636 537 385 27188 4745 1163 --
NM_152630chrX11295 ------
NM_152638chr1231281 973 373 ------
NM_152667chr2021018 286 21538 1399 ----
NM_152678chr311001 1738 ----
NM_152695chrX22116 1777 1101 ----
NM_152699chr323664 2965 ----11399
NM_152744chr723413 88 ------
NM_152745chr731189 939 316 ------
NM_152754chr73303 272 102 ------
NM_152756chr554052 3045 3024 1464 242 ------
NM_152774chr711669 12327 ----
NM_152780chrX5859 511 247 211 70 ------
NM_152787chrX42956 1435 926 706 ------
NM_152793chr721776 172 ------
NM_152835chr142952 1871 1004 862 12515 ----
NM_152862chr21160 ------
NM_152878chr2261566 1445 1294 1137 1131 1094 ------
NM_152896chr91759 ------
NM_152924chr1556638 6458 4691 1288 1024 ------
NM_152991chr112655 266 ------
NM_153029chr1654078 1232 954 792 22 13767 ----
NM_153035chr133068 2326 79 1426 ----
NM_153050chr2243427 3219 1251 305 ------
NM_153051chr2243427 3219 1251 305 ------
NM_153182chr333230 2103 342 ----1645
NM_153183chrX189 ------
NM_153184chr32337 24 ------
NM_153186chr9199 ------
NM_153188chr565573 5149 4443 4405 3982 2044 ------
NM_153207chr1221495 710 ------
NM_153251chr131264 ------
NM_153252chrX1416 ------
NM_153256chr1031863 609 234 ------
NM_153360chr201260 1171 1545 --
NM_153362chr61235 ------
NM_153367chr1053509 2856 1061 1047 225 ----13740
NM_153437chr9167 ------
NM_153450chr112357 192 ------
NM_153499chr1292771 2330 2080 2069 1942 1017 864 716 640 --12871 --
NM_153500chr1292771 2330 2080 2069 1942 1017 864 716 640 --12871 --
NM_153607chr522591 2533 ------
NM_153619chr151417 12510 ----
NM_153620chr7--11480 ----
NM_153634chr121439 1643 ----
NM_153649chr122167 1586 11972 ----
NM_153690chr31649 ------
NM_153748chr1221119 871 ------
NM_153756chr151863 1558 1223 399 369 ------
NM_153810chr1044940 4446 3452 607 1239 ----
NM_170692chr11758 1813 ----
NM_170706chr144356 4060 3495 3226 1917 ----
NM_170746chr11132 ------
NM_170751chr631204 162 37 ------
NM_170752chr631204 162 37 ------
NM_171998chrX2447 355 12210 ----
NM_171999chr181788 ------
NM_172037chr811491 1364 ----
NM_172058chr811465 ------
NM_172059chr811465 ------
NM_172060chr811465 ------
NM_172071chr136534 5639 306 11422 11731 --
NM_172128chr4--1649 ----
NM_172163chr11136 ------
NM_172169chr102439 382 ------
NM_172170chr102439 382 ------
NM_172171chr102439 382 ------
NM_172173chr102439 382 ------
NM_172216chr12102673 2232 1982 1971 1844 1165 919 766 618 542 --12773 --
NM_172226chr1292771 2330 2080 2069 1942 1017 864 716 640 --12871 --
NM_172240chr1211288 11310 ----
NM_172337chr141763 ------
NM_173082chr621474 1192 ------
NM_173083chr1--21253 1070 ----
NM_173156chr111891 ------
NM_173198chr922899 24 12272 ----
NM_173200chr922899 24 12272 ----
NM_173214chr1667903 7714 6394 2291 2102 246 16990 ----
NM_173355chr21268 ------
NM_173462chr1431629 655 346 ------
NM_173468chr474908 4613 4321 2409 438 261 119 ------
NM_173470chrX52574 2424 2388 1150 55 ------
NM_173475chr1621527 723 ------
NM_173508chr1--11062 ----
NM_173510chr2242614 2582 2492 428 22248 224 ----
NM_173511chr232697 2516 1425 ------
NM_173515chr61799 1643 ----
NM_173546chr31653 ------
NM_173552chr31225 ------
NM_173560chr62209 177 1198 ----
NM_173570chr321938 1691 2552 334 ----
NM_173582chr11105099 5054 4765 3975 2154 2000 1593 1310 835 303 11664 ----
NM_173595chr1253505 3490 1256 1214 565 ------
NM_173609chr151652 ------
NM_173642chr187916 7882 6701 3370 1470 1217 761 545 ------
NM_173653chr3--1387 ----
NM_173683chr81487 ------
NM_173694chrX12224 ------
NM_173698chrX41711 1624 36 28 1647 ----
NM_173808chr113932 ------
NM_173822chr212125 12102 ----
NM_173824chr31232 ------
NM_173832chr852458 2409 774 636 495 --11387 --
NM_174911chr852878 2636 638 489 394 ------
NM_175061chr7--11374 ----
NM_175077chr201408 ------
NM_175607chr31416 ------
NM_175612chr31416 ------
NM_175630chr23714 669 209 --1257 --
NM_175709chr2242929 2874 2182 42 --12882 --
NM_175733chr111478 ------
NM_175767chr511836 ------
NM_175848chr2011252 21421 421 ----
NM_175848chr2011252 21421 421 ----
NM_175849chr2011252 21421 421 ----
NM_175849chr2011252 21421 421 ----
NM_175850chr2011252 21421 421 ----
NM_175850chr2011252 21421 421 ----
NM_175852chr172819 2675 2583 1000 444 274 222 ------
NM_175856chr52647 594 141 ----
NM_175876chr142520 2505 2345 998 2605 45 ----
NM_176081chr1065675 4423 3744 1973 1891 307 ------
NM_176083chr1065675 4423 3744 1973 1891 307 ------
NM_176787chr183491 401 168 ------
NM_176795chr111119 ------
NM_176812chr202595 281 ------
NM_176871chr8103258 2912 2757 2605 2457 2315 880 799 486 326 ------
NM_177414chr121171 21 ------
NM_177424chr12582 28 ------
NM_177952chr14--126 ----
NM_177968chr212122 --1850 --
NM_177972chr1144237 1191 488 46 13802 ----
NM_177983chr2164 ------
NM_177985chr22649 313 ------
NM_177990chr201538 11984 ----
NM_178037chr1243252 1371 281 205 --13370 --
NM_178038chr1243252 1371 281 205 --13370 --
NM_178151chrX57681 6216 6201 2569 1638 1679 ----
NM_178152chrX57681 6216 6201 2569 1638 1679 ----
NM_178153chrX57681 6216 6201 2569 1638 1679 ----
NM_178191chr111148 ------
NM_178313chr21217 ------
NM_178426chr141832 1752 1617 552 ------
NM_178427chr141732 1652 1517 452 ------
NM_178496chr331098 428 246 ------
NM_178539chr1221564 799 ------
NM_178562chr72604 364 ------
NM_178812chr8192 ------
NM_178831chr742120 2062 814 519 ------
NM_178835chr4125 ------
NM_178864chr112247 177 ------
NM_180989chr1312188 1483 ----
NM_181054chr142149 129 1446 ----
NM_181349chr722686 328 ------
NM_181354chr8--1154 ----
NM_181356chr63998 852 414 ------
NM_181358chr194047 3426 3038 2625 2601 1670 1576 947 568 11661 ----
NM_181453chr231372 1287 466 11488 ----
NM_181457chr211205 ------
NM_181458chr211338 ------
NM_181492chr2221148 946 ------
NM_181504chr543353 668 136 95 13531 ----
NM_181521chr1676935 5580 5067 4759 2005 1907 1551 24998 1819 ----
NM_181523chr543353 668 136 95 13531 ----
NM_181524chr543353 668 136 95 13531 ----
NM_181659chr2063398 3226 3104 2116 1053 118 ------
NM_181659chr2063398 3226 3104 2116 1053 118 ------
NM_181670chr1211426 ------
NM_181713chr22623 379 1795 ----
NM_181783chr1241351 519 114 73 ------
NM_181784chr221038 553 ------
NM_181825chr222524 80 ------
NM_181832chr2253709 3182 2867 2607 1013 --12518 --
NM_181836chr511859 1661 ----
NM_181839chr811329 1390 ----
NM_181886chr4--11145 ----
NM_181887chr4--11145 ----
NM_181888chr4--11145 ----
NM_181889chr4--11145 ----
NM_181890chr4--11145 ----
NM_181891chr4--11145 ----
NM_181892chr4--11192 ----
NM_181893chr4--11145 ----
NM_182487chr9114033 3633 3486 3415 1777 968 847 570 552 145 48 14117 ----
NM_182503chr624398 1624 1735 ----
NM_182559chr121245 ------
NM_182565chr171193 ------
NM_182641chr17--21936 616 ----
NM_182679chr11703 ------
NM_182685chr12741 327 ------
NM_182691chr7297 29 ------
NM_182692chr7297 29 ------
NM_182697chr721473 1430 ------
NM_182700chr731491 645 607 1655 ----
NM_182717chr102958 321 ----1190
NM_182720chr102958 321 ----1190
NM_182721chr102958 321 ----1190
NM_182722chr102958 321 ----1190
NM_182723chr102958 321 ----1190
NM_182758chr1533907 2904 2759 ------
NM_182760chr33885 272 59 ------
NM_182764chr2031265 972 163 ------
NM_182830chr1442228 2180 1444 727 1701 ----
NM_182848chr1321193 32 11471 ----
NM_182853chr102958 321 ----1190
NM_182898chr755719 5412 1422 946 445 15938 ----
NM_182899chr755719 5412 1422 946 445 15938 ----
NM_182918chr2131215 1015 334 ------
NM_182948chr1125 ------
NM_182970chr2043981 798 562 529 ------
NM_183006chr2031266 1179 73 ------
NM_183011chr102958 321 ----1190
NM_183012chr102958 321 ----1190
NM_183013chr102958 321 ----1190
NM_183078chr653694 3398 2527 560 399 ------
NM_183243chr71446 ------
NM_183243chr71446 ------
NM_183353chrX11161 ------
NM_183380chr6------1107
NM_183381chr31994 ------
NM_183383chr31994 ------
NM_183384chr31994 ------
NM_183422chr131914 ------
NM_184234chr201743 ------
NM_194071chr765224 5207 1905 1461 1014 972 --11425 --
NM_194272chr15170 ------
NM_194278chr1453174 1244 1028 174 38 --1965 --
NM_194285chr1121124 268 ------
NM_194286chr1265763 5277 3954 1436 1167 156 15607 ----
NM_194292chr151730 1422 1396 657 111 ------
NM_194301chr141241 ------
NM_194317chr221738 384 12080 ----
NM_194434chr1845358 4671 4635 541 14300 ----
NM_194463chrX--1892 ----
NM_197941chr522620 1202 1985 1518 --
NM_197968chr131106 ------
NM_198040chr141054 972 775 221 11146 ----
NM_198074chr12430 106 ------
NM_198086chr1431992 1474 582 1240 ----
NM_198123chr84724 547 432 189 ------
NM_198124chr84724 547 432 189 ------
NM_198181chr152793 539 21144 1044 1353 --
NM_198186chr91536 ------
NM_198187chr91536 ------
NM_198215chr101907 ------
NM_198217chr131797 ------
NM_198218chr131797 ------
NM_198219chr131797 ------
NM_198225chr1031800 1280 1242 1746 ----
NM_198240chr123503 205 27 ------
NM_198268chr194047 3426 3038 2625 2601 1670 1576 947 568 11661 ----
NM_198269chr194047 3426 3038 2625 2601 1670 1576 947 568 11661 ----
NM_198270chrX42674 2449 1324 1149 ------
NM_198320chr1242061 1047 915 619 ------
NM_198336chr721739 21 ------
NM_198391chr2011213 ------
NM_198399chr31324 11449 ----
NM_198401chr81582 ------
NM_198465chrX11807 --12092 --
NM_198468chr641686 1053 944 835 ------
NM_198503chr11439 ------
NM_198504chr32321 48 ------
NM_198513chr811588 2639 488 ----
NM_198549chr133127 2840 1194 ------
NM_198560chr363599 2970 2753 2414 739 268 1719 ----
NM_198793chr354167 3733 2811 2802 2685 ------
NM_198794chr1411139 ------
NM_198859chr334152 1462 1351 14344 ----
NM_198956chr731491 645 607 1655 ----
NM_198989chr132593 39 ------
NM_198995chr181563 ------
NM_199003chr821167 354 ------
NM_199051chr1140 ------
NM_199076chr103957 387 87 ------
NM_199169chr2061086 940 298 237 185 21 --21381 777 --
NM_199170chr2061086 940 298 237 185 21 --21381 777 --
NM_199171chr2061086 940 298 237 185 21 --21381 777 --
NM_199188chr1243772 3597 3481 3012 ------
NM_199190chr1243772 3597 3481 3012 ------
NM_199229chr211517 11704 ----
NM_199282chr1741396 361 349 313 ------
NM_199355chr161109 21202 39 ----
NM_199421chr1443533 1377 931 479 ----1189
NM_199436chr232696 2617 571 ------
NM_199454chr143979 3645 1340 573 ------
NM_199461chr1032841 1056 485 21446 427 ----
NM_199462chr164462 3989 3802 3352 1820 1392 1438 ----
NM_199482chr21340 1406 ----
NM_199483chr201282 ------
NM_199487chr201148 ------
NM_201266chr252964 1036 845 831 302 12158 ----
NM_201278chr11--22201 146 ----
NM_201279chr252964 1036 845 831 302 12158 ----
NM_201280chr631306 624 572 ------
NM_201281chr11--22201 146 ----
NM_201378chr81888 ------
NM_201379chr81888 ------
NM_201380chr81888 ------
NM_201381chr81888 ------
NM_201382chr81888 ------
NM_201383chr81888 ------
NM_201384chr81888 ------
NM_201428chr1121624 1417 ----11168
NM_201429chr1121624 1417 ----11168
NM_201430chr1121550 1343 ----11094
NM_201432chr1766609 6049 5712 5061 5053 382 16556 1302 --
NM_201433chr1766609 6049 5712 5061 5053 382 16556 1302 --
NM_201568chr111891 ------
NM_201569chr111891 ------
NM_201574chr21216 ------
NM_201591chr421815 1689 ------
NM_201592chr421815 1689 ------
NM_201999chr41951 ------
NM_203283chr41503 ------
NM_203284chr41503 ------
NM_203291chr181204 ------
NM_203292chr181197 ------
NM_203304chr193841 807 157 ------
NM_203327chr2064446 4322 3509 2778 1783 370 --21594 1305 --
NM_203341chr11749 ------
NM_203342chr163468 3002 1324 662 259 198 21224 153 ----
NM_203343chr163468 3002 1324 662 259 198 21224 153 ----
NM_203354chr143804 675 250 ------
NM_203355chr143804 675 250 ------
NM_203356chr143804 675 250 ------
NM_203379chr101756 ------
NM_203380chr101756 ------
NM_203390chr811483 ------
NM_203417chr213358 345 227 ------
NM_203418chr213358 345 227 ------
NM_203434chr921156 113 ------
NM_203446chr2132434 1011 451 ------
NM_203494chr151179 ------
NM_203504chr432590 2333 2020 11934 ----
NM_203505chr432590 2333 2020 11934 ----
NM_203506chr171215 ------
NM_205768chr131792 811 325 ------
NM_205833chrX2304 62 ------
NM_205848chr162812 2690 2594 1062 476 66 ------
NM_206594chr143465 2787 1201 180 185 12956 --
NM_206595chr143465 2787 1201 180 185 12956 --
NM_206853chr633909 3396 3027 1295 ----
NM_206854chr645170 4657 4288 3447 11556 ----
NM_206855chr656135 5622 5253 4412 271 12521 ----
NM_206876chr243330 3064 478 385 ------
NM_206909chr866973 6761 6465 5678 1413 1310 46027 5510 5127 2547 ----
NM_207015chr31938 ------
NM_207113chr72513 56 1452 ----
NM_207123chr41870 ------
NM_207299chr91423 ------
NM_207303chr1043691 3422 2675 171 --23659 48 --
NM_207304chr131604 1891 ----
NM_207317chr5--1406 ----
NM_207322chr1531983 1867 1820 ------
NM_207352chr43676 504 171 ------
NM_207372chr1032447 1988 288 1235 ----
NM_207387chr1731700 1214 631 11744 ----
NM_207391chr193336 286 235 1851 ----
NM_207396chr121760 115 11372 ----
NM_207406chr486134 5840 5358 4180 1222 991 947 278 1653 15632 --
NM_207429chr1121737 429 ------
NM_207442chr142854 110 132 ----
NM_207469chr201176 ------
NM_207481chr221273 290 1419 ----
NM_207517chr1521523 746 ------
NM_207645chr1121004 543 ------
NM_212467chr1552061 1693 826 682 407 ------
NM_212543chr33696 596 115 ------
NM_212554chr1011515 1398 ----
NM_213569chr10124 ------
NM_213589chr225133 2133 ------
NM_213606chr1032672 1009 499 ------
NM_213611chr121144 ------